We narrowed to 7,942 results for: RAP
-
Plasmid#175471PurposeProtein expression in bacterial cells. FERM domain, M1-E346. Contains L281R and H288A point mutations that reduce binding to CD44.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Pet22b-YAPL318E
Plasmid#166444PurposeBacterial expression of 6x His tagged YAPL318EDepositorInsertYAPL318E (YAP1 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-YAP4LE
Plasmid#166445PurposeBacterial expression of 6x His tagged YAP4LEDepositorInsertYAP4LE (YAP1 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
S1 1029 CP APOBEC3 no UGI
Plasmid#135352PurposeExpression of circular permutant of nSpyCas9 lacking uracil DNA glycosylase inhibitor at amino acid position 1029 encoding rat cytosine deaminase, rAPOBEC3 at the N-terminusDepositorInsertrAPOBEC3-nSpyCas9 aa 1029
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 C264A
Plasmid#129293PurposeGateway entry clone encoding human ATG3 C264A (catalytic inactive)DepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged Cysteine 264 to AlanineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 allKR
Plasmid#129295PurposeGateway entry clone encoding human ATG3 with all 22 lysine residues mutated to arginineDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneMutationchanged all 22 Lysine residues to ArginineAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 allKR
Plasmid#129298PurposeExpresses pCMV 3xFLAG-ATG3 allKR (all lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
Tags3xFLAGExpressionMammalianMutationchanged all 22 Lysine residues to ArgininePromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 1-13 KR
Plasmid#129299PurposeExpresses pCMV 3xFLAG-ATG3 1-13 KR (first thirteen lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
Tags3xFLAGExpressionMammalianMutationchanged first 13 Lysine residues to ArgininePromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 14-22 KR
Plasmid#129300PurposeExpresses pCMV 3xFLAG-ATG3 14-22 KR (last nine lysines mutated to arginine) in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
Tags3xFLAGExpressionMammalianMutationchanged last 9 Lysine residues to ArgininePromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-ATG3 K295R
Plasmid#129302PurposeExpresses pCMV 3xFLAG-ATG3 K295R in mammalian cellsDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
Tags3xFLAGExpressionMammalianMutationchanged Lysine 295 to ArgininePromoterCMVAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1D4 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4A6-mCherry
Plasmid#73424PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4A6.DepositorInsertPromoter 4A6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4A6 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1E4-mCherry
Plasmid#73426PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1E4.DepositorInsertPromoter 1E4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1E4 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1B6-mCherry
Plasmid#73420PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1B6.DepositorInsertPromoter 1B6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1B6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3H5-mCherry
Plasmid#73419PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3H5.DepositorInsertPromoter 3H5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3H5 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only