We narrowed to 3,493 results for: cgas
-
Plasmid#198780PurposeDrives specific expression in the ASI neuronsDepositorInsertPgpa-4-GAL4-SK(DBD)-VP64
ExpressionWormAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP
Plasmid#162033PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsGFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgSat-MTSb/BFP/pdCas9-C1
Plasmid#162761PurposeExpressing dCas9 and sgRNA containg MTSa targeting centromeresDepositorInsertdCas9 and sgRNA(SL2-sgSat-MTSb)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceMarch 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC20
Plasmid#198783PurposeDrives specific expression in the ASK neuronsDepositorInsertPsra-9-GAL4-SK(DBD)-VP64
ExpressionWormAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1102
Plasmid#119246Purposeknockdown phzA1 in P. aeruginosaDepositorInsertsgRNA phzA1 (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #1
Plasmid#198757Purposeconditional knockdown of FAKDepositorInsertshFAK #1 (PTK2 Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
1161F
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-2
Plasmid#193695PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX2TK-YAP-WW1-RRK
Plasmid#104306Purposebacterial expression of RKK mutant WW domain 1 of YAP; RRK mutant binds to PPxY where Y is phosphorylatedDepositorInsertYAP WW1 domain (YAP1 Human)
TagsGSTExpressionBacterialMutationWW domain 1 RRK mutant (TTAAATCACATCGATCAG to AGA…PromotertacAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.H2B.RFP
Plasmid#170369PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-TdT-guide1-PGK-Puro
Plasmid#102903PurposeEBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Includes PGK-puro selection cassette.DepositorInsertTdT-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-hisG
Plasmid#89954PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting hisG.DepositorInserthisG gRNA
ExpressionBacterialPromoterpTetAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC441
Plasmid#91218Purposeprotoplast vector for targeted deletion of MLO gene in barley (PvUbi1 promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC437
Plasmid#91219Purposeprotoplast vector for targeted deletion of MLO gene in barley (CmYLCV promoter driving the gRNA array)DepositorInsertgRNAs targeting MLO gene in barley
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304 mNG PH PLCD1
Plasmid#233254PurposeExpression of mNeonGreen-tagged PH domain of PLCD1DepositorInsertPLCD1
UseLentiviralAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only