We narrowed to 82,333 results for: Gene
-
Plasmid#71991PurposeExpresses the extracellular region of the Netrin G1, isoform h protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Ntng1.e-AP-His
Plasmid#71988PurposeExpresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lrrc4c-AP-His
Plasmid#71959PurposeExpresses the extracellular region of the LRRC4C protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(S)-AP-His
Plasmid#72014PurposeExpresses the Sema3B protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.d-AP-His
Plasmid#71966PurposeExpresses the extracellular region of the Neogenin 1, isoform d protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH672-SUP35-Y351C
Plasmid#29733DepositorInsertSUP35 gene encoding translation release factor 3 from S. cerevisiae (SUP35 Budding Yeast)
ExpressionYeastMutationY351C mutant gene of SUP35 including genomic sequ…Available SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSEVA331Bb
Plasmid#78269PurposepSEVA331 with Biobrick multiple cloning siteDepositorTypeEmpty backboneAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-Fc-His
Plasmid#72137PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Islr2.b-Fc-His
Plasmid#72077PurposeExpresses the extracellular region of the Islr2.b protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
MALT1 (3K0W)
Plasmid#25306PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertmalt1.129.326 (MALT1 Human)
TagsHisExpressionBacterialMutationamino acid residues 128-326Available SinceAug. 16, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJN601
Plasmid#59790Purposezf1::yfp fusion with floxed unc-119(+) within an intron of yfp. For creating zf1::yfp knock-ins using unc-119 as a markerDepositorInsertsZF1 domain from pie-1
N-terminal half of yfp with introns
intron containing floxed unc-119 gene in reverse orientation
C-terminal half of yfp with introns
ExpressionWormAvailable SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema4c-Fc-His
Plasmid#72156PurposeExpresses the extracellular region of the Sema4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-Fc-His
Plasmid#72069PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-AP-His
Plasmid#71943PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.f-Fc-His
Plasmid#72094PurposeExpresses the extracellular region of the Neogenin 1, isoform f protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.b-AP-His
Plasmid#71964PurposeExpresses the extracellular region of the Neogenin 1, isoform b protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Dscam1_7.27.22 EC10-Fc-His
Plasmid#72186PurposeExpresses the 10 N-terminal extracellular domains of the Dscam, isoform 7.27.22 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertDscam1_7.27.22
TagsFc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.f-AP-His
Plasmid#71968PurposeExpresses the extracellular region of the Neogenin 1, isoform f protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.g-AP-His
Plasmid#71969PurposeExpresses the extracellular region of the Neogenin 1, isoform g protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp1-AP-His
Plasmid#71971PurposeExpresses the extracellular region of the Neuropilin 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
PxylA
Plasmid#55178PurposeXylose-inducible promoterDepositorInsertxylA promoter
UseSynthetic Biology; Bacillus biobrick boxPromoterxylAAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema4c-AP-His
Plasmid#72030PurposeExpresses the extracellular region of the Sema4C protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJN601
Plasmid#59790Purposezf1::yfp fusion with floxed unc-119(+) within an intron of yfp. For creating zf1::yfp knock-ins using unc-119 as a markerDepositorInsertsZF1 domain from pie-1
N-terminal half of yfp with introns
intron containing floxed unc-119 gene in reverse orientation
C-terminal half of yfp with introns
ExpressionWormAvailable SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
EcNR1 Strain
Bacterial Strain#26930DepositorBacterial ResistanceAmpicillinAvailable SinceJan. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Neo1.f-Fc-His
Plasmid#72094PurposeExpresses the extracellular region of the Neogenin 1, isoform f protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only