We narrowed to 1,718 results for: cag promoter
-
Plasmid#62686PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBT255_(pCA-GFP4m)
Plasmid#36877DepositorInsertGFP
ExpressionMammalianMutationF64L; S65T; V163A; S175GPromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJM466 EF1a VP16-ZF43 (TUPV2)
Plasmid#138730PurposemMoClo TUPV, with EF1alpha promoter and VP16-ZFa in the MCSDepositorInsertVP16-ZF43
UseSynthetic BiologyExpressionMammalianPromoterhEF1alphaAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE048 ZF43x6-S mKate2 (TUPV1)
Plasmid#138728PurposemMoClo TUPV, with ZF43x6-S promoter and mKate2 in the MCSDepositorInsertZF43x6-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-SpacedAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE047 ZF43x3-S mKate2 (TUPV1)
Plasmid#138727PurposemMoClo TUPV, with ZF43x3-S promoter and mKate2 in the MCSDepositorInsertZF43x3-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x3-SpacedAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE045 ZF43x6-C mKate2 (TUPV1)
Plasmid#138725PurposemMoClo TUPV, with ZF43x6-C promoter and mKate2 in the MCSDepositorInsertZF43x6-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-CompactAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE044 ZF43x3-C mKate2 (TUPV1)
Plasmid#138724PurposemMoClo TUPV, with ZF43x3-C promoter and mKate2 in the MCSDepositorInsertZF43x3-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x3-CompactAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE049 ZF43x12-S mKate2 (TUPV1)
Plasmid#138729PurposemMoClo TUPV, with ZF43x12-S promoter and mKate2 in the MCSDepositorInsertZF43x12-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x12-SpacedAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARA (pKD-G1)
Plasmid#62680PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARB (pKD-G2)
Plasmid#62681PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARD (pKD-G4)
Plasmid#62683PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATJ (pKD-G8)
Plasmid#62687PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -EGFP
Plasmid#246994PurposeCan be used to generate AAV virus that will express EGFP from EF1α core promoterDepositorInsertEGFP
UseAAVPromoterEF1αAvailable SinceApril 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -NaChBac
Plasmid#246997PurposeCan be used to generate AAV virus that will express NaChBac from EF1α core promoterDepositorInsertNaChBac
UseAAVPromoterEF1αAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA2
Plasmid#166908PurposeLentivirus for inducible knockdown of human AHRDepositorInsertAHR shRNA
UseLentiviralExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgSTAT3-1
Plasmid#121425PurposesgSTAT3-1 sequence: GTCAGGATAGAGATAGACCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgSTAT3-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only