We narrowed to 14,304 results for: TIM;
-
Plasmid#161306PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC26A9 (SLC26A9 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC35A5_STOP
Plasmid#161277PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35A5 (SLC35A5 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC22A31_STOP
Plasmid#161202PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC22A31 (SLC22A31 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC25A18_STOP
Plasmid#161169PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A18 (SLC25A18 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC24A3_STOP
Plasmid#161144PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC24A3 (SLC24A3 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC18 Apln5-HA-FlpO-pA-LoxP-PGK-Neo-pA-LoxP-Apln3 (SO89)
Plasmid#159222PurposeCan be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpODepositorInsertApln 5'-FlpO-WPRE-Sv40pA-LoxP-PGK-Neo-pA-LoxP-Apln
ExpressionMammalianPromoterAplnAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD3-P2A-CD90.2
Plasmid#163337PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the mPGK promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromotermPGKAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD3-P2A-CD90.2
Plasmid#163335PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the hFTH1 promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromoterhFTH1Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT7
Plasmid#127515PurposePlasmid encodes H. sapiens codon optimized Integrase 7.DepositorInsertIntegrase 7 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianMutationIn 2126 position an G mutated for an T changed th…Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v5
Plasmid#145152PurposeMammalian expression plasmid for soluble ACE2 (protease domain) high affinity variant 5DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
ExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2-T92Q
Plasmid#145156PurposeMammalian expression plasmid for soluble ACE2 (protease domain) T92Q glycosylation mutantDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
ExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2 M133, 138, 186ILeu
Plasmid#127276PurposeExpresses human ELL2 with M133, 138, 186ILeu to prevent internal Met initiation peptides and contains middle HA tag that doesn't disrupt functionDepositorInsertELL2 (ELL2 Human)
ExpressionMammalianMutationM133, 138, 186 to Ileu, HA tag at XbaI after Met …PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
RV-cag-Dio-Kif5c-2A-tdt
Plasmid#87668Purposeretroviral vector, conditional expression membrane Tdtomato and Kif5Cdelta560DepositorInsertKif5C-P2A-mTdt (Kif5c Rat)
UseRetroviralTagspalmitylationMutationmotor domain aa1-560 present, V40A, E125V (see de…PromoterCAGAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001148355)
Plasmid#77753Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
IPMK gRNA (BRDN0001146121)
Plasmid#78075Purpose3rd generation lentiviral gRNA plasmid targeting human IPMKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only