We narrowed to 83,772 results for: Mycs
-
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-HA
Plasmid#162109PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW2072
Plasmid#154334PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mScarlet-I (dpi)::3xMyc::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-HA
Plasmid#162103PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-HA
UseLentiviralTagsVSVg-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-HA-FLAG
Plasmid#162106PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-FLAG
UseLentiviralTagsVSVg-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-HA-AU1
Plasmid#162116PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-HA-AU1
UseLentiviralTagsProtC-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-HA-AU1
Plasmid#162087PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-HA-FLAG
Plasmid#162095PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-HA-FLAG
UseLentiviralTagsProtC-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_FKBP25-V5-APEX2
Plasmid#83418PurposeExpressed FKBP25/FKBP3-V5-APEX2 in mammalian cellDepositorInsertPeptidyl-prolyl cis-trans isomerase FKBP3 (FKBP3 Human)
TagsAPEX2 and V5ExpressionMammalianPromoterCMV-FAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-HA-AU1
Plasmid#162113PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-HA-AU1
UseLentiviralTagsStrepTagII-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-HA-FLAG
Plasmid#162092PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-HA-FLAG
UseLentiviralTagsStrepTagII-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Az
Plasmid#197101PurposeTo express the azidophenylalanine-specific variant of Methanocaldococcus jannaschii TyrRS and its cognate amber suppressor tRNA and allow UAG codon to be translated into azidophenylalanineDepositorInsertTyrRS variant, amber suppressor tRNA, kanamycin resistance gene
ExpressionBacterialMutationThr32, Asn107, Pro158, Leu159, Gln162, Arg286 (Ty…Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-HA-FLAG
Plasmid#162115PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-HA-FLAG
UseLentiviralTagsProtC-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-HA-FLAG
Plasmid#162086PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-HA-FLAG
UseLentiviralTagsVSVg-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-HA-AU1
Plasmid#162093PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-HA-AU1
UseLentiviralTagsStrepTagII-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-HA-AU1
Plasmid#162096PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-HA-AU1
UseLentiviralTagsProtC-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-ProtC-HA
Plasmid#162083PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-ProtC-HA
UseLentiviralTagsVSVg-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only