We narrowed to 7,457 results for: mCherry
-
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYL237
Plasmid#173194PurposeCRISPR donor plasmid for making the RNA-binding mutant EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorInsertEZH2 RNA-binding mutant
UseCRISPRExpressionMammalianAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGF172
Plasmid#96998Purposeish1 mCherry insertion cassette with ura4+ geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + ura4(…PromoterN/AAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16 (B695)
Plasmid#92031PurposeExpresses CRY2 (full length, intact NLS) fusion with Gal4DBD(aa1-147) fused to VP16AD (truncated), downstream of mCherry-IRES.DepositorAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-WTSI
Plasmid#80486PurposepiggyBac transposon for dox-inducible expression of the WTSI polycistronic reprogramming cassette (with mCherry)DepositorInsertWTSI
UsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_ChR2_mCherry (AAV PHP.eB)
Viral Prep#213856-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiVIPe4_ChR2_mCherry (#213856). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the VIP interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211689PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211690PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211691PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBS1397 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 W385G]
Plasmid#118812PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1400 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G295F]
Plasmid#118814PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1393 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 deltaRRM]
Plasmid#118805PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationDeletion of RRM in full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1394 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 deltaCTD]
Plasmid#118806PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationDeletion of CTD in full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1331 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 W385G]
Plasmid#107854PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1337 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G309S]
Plasmid#107849PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 6xΦ]
Plasmid#107846PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll hydrophobics combined in six clusters in spli…Available SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1109 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 ∆CTD]
Plasmid#107841PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationDeletion of C-terminal domain in splicing reporterAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only