We narrowed to 7,512 results for: mcherry
-
Plasmid#193075Purposeconstitutive expression of mCherry fused to human Gata2 with mutation A318T in mammalian cellsDepositorInsertmCh-GATA2-A318T
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-L321F
Plasmid#193076Purposeconstitutive expression of mCherry fused to human Gata2 with mutation L321F in mammalian cellsDepositorInsertmCh-GATA2-L321F
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-R330Q
Plasmid#193077Purposeconstitutive expression of mCherry fused to human Gata2 with mutation R330Q in mammalian cellsDepositorInsertmCh-GATA2-R330Q
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-T354M
Plasmid#193078Purposeconstitutive expression of mCherry fused to human Gata2 with mutation T354M in mammalian cellsDepositorInsertmCh-GATA2-T354M
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-L359V
Plasmid#193079Purposeconstitutive expression of mCherry fused to human Gata2 with mutation L359V in mammalian cellsDepositorInsertmCh-GATA2-L359V
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-R361L
Plasmid#193080Purposeconstitutive expression of mCherry fused to human Gata2 with mutation R361L in mammalian cellsDepositorInsertmCh-GATA2-R361L
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-R362Q
Plasmid#193081Purposeconstitutive expression of mCherry fused to human Gata2 with mutation R362Q in mammalian cellsDepositorInsertmCh-GATA2-R362Q
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-C373R
Plasmid#193082Purposeconstitutive expression of mCherry fused to human Gata2 with mutation C373R in mammalian cellsDepositorInsertmCh-GATA2-C373R
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-R396Q
Plasmid#193083Purposeconstitutive expression of mCherry fused to human Gata2 with mutation R396Q in mammalian cellsDepositorInsertmCh-GATA2-R396Q
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one_Bip gRNA1
Plasmid#183696PurposeExpresses gRNA targeting chinise hamster Bip (Hspa5) with CRISPRa components and mCherry, blasticidin selectiveDepositorInsertgRNA targeting chinese hamster Bip (Hspa5)
UseCRISPRAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYL237
Plasmid#173194PurposeCRISPR donor plasmid for making the RNA-binding mutant EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorInsertEZH2 RNA-binding mutant
UseCRISPRExpressionMammalianAvailable sinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGF172
Plasmid#96998Purposeish1 mCherry insertion cassette with ura4+ geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + ura4(…PromoterN/AAvailable sinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16 (B695)
Plasmid#92031PurposeExpresses CRY2 (full length, intact NLS) fusion with Gal4DBD(aa1-147) fused to VP16AD (truncated), downstream of mCherry-IRES.DepositorAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-TAC-WTSI
Plasmid#80486PurposepiggyBac transposon for dox-inducible expression of the WTSI polycistronic reprogramming cassette (with mCherry)DepositorInsertWTSI
UsePiggybac transposonExpressionMammalianPromotertetOAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_ChR2_mCherry (AAV1)
Viral prep#213856-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiVIPe4_ChR2_mCherry (#213856). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the VIP interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only