We narrowed to 9,774 results for: pho
-
Plasmid#195224PurposeMammalian expression vector containing GFP tagged Podocalyxin. PKC phosphomimetic mutant.DepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pMx/ATP8B2-HA
Plasmid#209227PurposeMammalian expression of ATP8B2DepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP8B2(E171Q)-HA
Plasmid#209254PurposeMammalian expression of ATP8B2 mutant E171QDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-hWIPI2B-3×FLAG
Plasmid#215510PurposeExpresses FLAG tagged human WIPI2B.DepositorInsertWD-repeat protein interacting with phosphoinositides 2B (WIPI2 Human)
UseRetroviralTags3×FLAGExpressionMammalianAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-PRF1-Exon3
Plasmid#209075PurposeTargeting vector for the human PRF1 locus to replace exon 3 with repaired exon 3DepositorInsertPRF1-Exon3 HDRT (PRF1 Human)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMX-IG-ATG3 (H262A)
Plasmid#212027PurposeExpresses untagged ATG3 (H262A) in mammalian cellsDepositorAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-AncSZ
Plasmid#214235PurposeBacterial expression construct of AncSZ, an kinase domain engineered through ancestorial reconstruction of the kinase domains of both SYK and ZAP-70. For in vitro protein tyrosine phosphorylationDepositorInsertSyk kinase (SYK Human)
Tags6xHisExpressionBacterialMutationSequence gained through ancestral reconstruction …PromoterT7Available SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ST-P2A-pSC-CAAX
Plasmid#207637PurposeA plasmid encoding EGFP fused to SpyTag (ST) and photocaged SpyCatcher (pSC) localized to the cell membrane via CAAX tag.DepositorInsertEGFP-SpyTag-P2A-photocaged SpyCatcher-CAAX
ExpressionMammalianMutationAmber stop codon at SC's critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Shim_ProRS_TP_GFP_pK7FWG2
Plasmid#202651PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ProRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_ThrRS_TP_GFP_pK7FWG2
Plasmid#202652PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic ThrRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_TrpRS_TP_GFP_pK7FWG2
Plasmid#202653PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic TrpRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AspRS_TP_GFP_pK7FWG2
Plasmid#202647PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AspRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_GlyRS_TP_GFP_pK7FWG2
Plasmid#202648PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic GlyRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_AsnRS_TP_GFP_pK7FWG2
Plasmid#202649PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic AsnRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Shim_MetRS_TP_GFP_pK7FWG2
Plasmid#202650PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from putative cytosolic MetRS
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWalium Htt19Q-mCherry
Plasmid#201248Purposeallows the expression of the insert in Drosophila melanogasterDepositorInsertHuntingtin (HTT Human)
ExpressionInsectAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRPA_sgRNA1
Plasmid#201622PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRPA (SNRPA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only