We narrowed to 16,105 results for: grna
-
Plasmid#225987PurposeTo make Gateway entry clone of CRISPR guide RNA under AtU6pDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
zCREST3:redCas9; control_gRNA
Plasmid#199334PurposepDEL157; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous control sgRNADepositorInsertszCREST3
Cas9
control sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SpCas9_USP7 Exon 3 gRNA
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPRv2 Neo-MORC3_gRNA_1
Plasmid#235529PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_3
Plasmid#235530PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable sinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(CTRL)-hSyn-mCherry
Plasmid#231405PurposeCTRL knockdown gRNADepositorInsertsgRNA(CTRL)
UseAAV and CRISPRExpressionMammalianPromoterU6Available sinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA mcherry
Plasmid#167910PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_Luciferase_sgRNA
Plasmid#155094Purposelentiviral plasmid expressing Cas9 and gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-NONO-1
Plasmid#127654PurposeKnock-out of human NONO (guide only)DepositorInsertNONO sgRNA (NONO Human)
ExpressionMammalianAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only