We narrowed to 895 results for: gcat
-
Plasmid#231149PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1proDepositorInsertTREX2 and mobile gRNA targeting NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbSTM-5'UTR
Plasmid#231148PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbSTM-5?UTRDepositorInsertTREX2 and mobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Nat-ADE2
Plasmid#232106PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg-ADE2
Plasmid#232107PurposeExpresses estradiol-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterZ3Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
px330-Alb-3
Plasmid#162546PurposesgRNA targeting AlbDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Zfp219-g1)-PGKpuroBFP-W
Plasmid#105021PurposeLentiviral gRNA plasmid targeting mouse Zfp219 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4B-TSS-guide1
Plasmid#125484PurposeCRISPR-mediated activation of C2CD4B. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 C2CD4A/B-enh3-guide1
Plasmid#125473PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs17205526 (C2CD4A/B GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROT gRNA (BRDN0001145682)
Plasmid#77709Purpose3rd generation lentiviral gRNA plasmid targeting human CROTDepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRGUK gRNA (BRDN0001145468)
Plasmid#78084Purpose3rd generation lentiviral gRNA plasmid targeting human LRGUKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADPGK gRNA (BRDN0001147802)
Plasmid#77999Purpose3rd generation lentiviral gRNA plasmid targeting human ADPGKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MPP2 gRNA (BRDN0001147770)
Plasmid#77809Purpose3rd generation lentiviral gRNA plasmid targeting human MPP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK2 gRNA (BRDN0001148143)
Plasmid#77764Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKNK2 gRNA (BRDN0001148155)
Plasmid#77765Purpose3rd generation lentiviral gRNA plasmid targeting human MKNK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ARSG gRNA (BRDN0001148698)
Plasmid#77642Purpose3rd generation lentiviral gRNA plasmid targeting human ARSGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G1 gRNA (BRDN0001146475)
Plasmid#77441Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1G1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAN3 gRNA (BRDN0001146135)
Plasmid#77424Purpose3rd generation lentiviral gRNA plasmid targeting human PAN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAN3 gRNA (BRDN0001146176)
Plasmid#77426Purpose3rd generation lentiviral gRNA plasmid targeting human PAN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only