We narrowed to 51,706 results for: cha;
-
Plasmid#53048PurposeExpresses alpha subunit for hKCNQ1 channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily KQT member 1 (KCNQ1 Human)
UseXenopus oocyte expressionPromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
TPC2-D276K-G-GECO1.2
Plasmid#207142PurposeFusion of Ca2+ reporter and pore-dead lysosomal Ca2+-permeable channelDepositorInsertTPC2N2 (TPCN2 Human)
TagsG-GECO1.2ExpressionMammalianMutationChanged Aspartate 276 to LysinePromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-hSyn-ASAP2s
Plasmid#101276PurposeGenetically encoded voltage indicator (GEVI) ASAP2s in AAV vector for neuron-specific expression using the promoter hSyn1DepositorInsertASAP2s
UseAAVExpressionMammalianPromoterhSyn (human synapsin)Available SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-TBX20a
Plasmid#98620PurposeGateway entry TOPO TA cloning vector for TBX20aDepositorInsertTbx20a (Tbx20 Mouse)
UseTopo ta cloning vectorAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-IRES-miR34a-P2
Plasmid#64786PurposeLuciferase expression driven by miR-34a promoter P2DepositorInsertmiR-34a promoter P2 (MIR34A Human)
UseLuciferaseAvailable SinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pRVdGL-1Cre
Plasmid#98038PurposeSecond-generation rabies viral vector genomeDepositorInsertmCre
ExpressionMammalianPromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVdG-4GCaMP6f
Plasmid#98035PurposeFirst-generation rabies viral vector genomeDepositorInsertGCaMP6f
ExpressionMammalianPromoterCMVAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRVdGL-1EGFP
Plasmid#98036PurposeSecond-generation rabies viral vector genomeDepositorInsertEGFP
ExpressionMammalianPromoterCMVAvailable SinceMarch 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDE722
Plasmid#103022Purposeexpression of a Cpf1 programming crRNA targetting CAN1 (crCAN1-4S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pUDE714
Plasmid#103021Purposeexpression of a Cpf1 programming crRNA targetting HIS4 (crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf35
Plasmid#12723PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf35 (J3R Vaccinia Virus)
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pACYC-mTET1-N
Plasmid#81056Purposebacterial expression of N-terminus of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationN-terminus, amino acids 301-1366PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only