We narrowed to 7,771 results for: Pol
-
Plasmid#210887PurposeInsect expression of human COP1 fragment A386 to V731. N-terminal 6X His tag with TEV cleavage.DepositorInsertCOP1:A386-V731 (COP1 Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_PRPF4:1-522
Plasmid#210896PurposeInsect expression of full-length human PRPF4. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertPRPF4:M1-E522 (PRPF4 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_CORO1A:1-461
Plasmid#210891PurposeInsect expression of full-length human CORO1A. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertCORO1A:M1-K461 (CORO1A Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBD-BirA_WDR91:392-747
Plasmid#210880PurposeInsect expression of human WDR91 fragment P392 to A747. N-terminal biotin acceptor peptide tag and C-terminal 6X His tag.DepositorInsertWDR91:P392-A747 (WDR91 Human)
TagsGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGExpressionInsectMutationwild typePromoterPolyhedrinAvailable sinceMarch 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MERS Mpro - His6-SUMO with autoprocessing - MSAVLQ/SGLVKM---MGVVMQ/SGVRKVTYGTAHWL
Plasmid#204814PurposeBacterial expression of MERS MproDepositorAvailable sinceFeb. 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
YIp128-CUP1-His6-CUbo(K48R/K63R)-GFP
Plasmid#212795PurposeCopper-inducible expression of the artificial test substrate His6-CUbo(K48R/K63R)-GFP in budding yeastDepositorInsertHis6-CUbo(K48R/K63R)-GFP
UseIntegrative vectorExpressionYeastMutationCUb(K48R/K63R)PromoterCUP1Available sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-EGFR*-CUbo-GFP
Plasmid#212815PurposeConstitutive or doxycycline-inducible expression of EGFR*-CUbo-GFP in mammalian cellsDepositorAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
EV-D68 2A protease; 6xHis-MBP-TEV tag, low expression levels
Plasmid#204803PurposeBacterial expresison of Enterovirus D68 2A proteaseDepositorInsertD68 2A protease
ExpressionBacterialAvailable sinceDec. 11, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
PABPC1_544-626_pGEX6P1
Plasmid#209790PurposeBacterial expression of PABPC1 Mlle domainDepositorInsertMlle domain of PABPC1 (PABPC1 Human)
TagsGSTExpressionBacterialMutationaa 544-626 onlyPromotertacAvailable sinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A_delta aa 111-136
Plasmid#201466PurposeExpresses a mutant form of human RAD23A lacking residues 111-136. Variant of plasmid pCMV6-AN-DDK_WT RAD23A.DepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationLacks residues 111-136Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A_delta aa 137-160
Plasmid#201467PurposeExpresses a mutant form of human RAD23A lacking residues 137-160. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationLacks residues 137-160Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A_delta aa 202-230
Plasmid#201468PurposeExpresses a mutant form of human RAD23A lacking residues 202-230. Variant of plasmid pCMV6-AN-DDK_WT RAD23A.DepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationLacks residues 202-230Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A_delta aa 287-316
Plasmid#201469PurposeExpresses a mutant form of human RAD23A lacking residues 287-316. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationLacks residues 287-316Available sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-mOrange2-NEDD1-gTBD
Plasmid#196878PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange. Used to displace endogenous gamma-TuRC from the centrosome.DepositorInsertmOrange2-N-gTBD
UseCre/LoxExpressionMammalianPromoterQuimeric CAGAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-Llgl1-WPRE-UbC-Emerald
Plasmid#203805PurposeLentiviral vector plasmid expressing mouse Llgl1 under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable sinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196886PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-GFP_mmu-miR-292b-3p_sponge
Plasmid#132622PurposeExpresses a TurboGFP transcript with test microRNA sponge for mmu-miR-292b-3p as 3'UTR; serves as template for other microRNA spongesDepositorInsertstop codon, mmu-miR-292b-3p sponge sequence and polyA signal
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTREAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only