We narrowed to 13,137 results for: sequence
-
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits
-
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGGB006
Plasmid#48823PurposeProvides an ER signal sequence as GreenGate N-terminal tag module.DepositorInsertsignal sequence ER
UseGolden gate compatible cloning vectorTagsExpressionMutationPromoterAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
p218 pCMV-CREM-L
Plasmid#8396DepositorInsertCREM-L
UseCre/LoxTagsExpressionMammalianMutationmodified Cre, single LOX 511 sitePromoterAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSKB3.MPN314
Plasmid#11433DepositorInsertcell division protein
UseTagsExpressionBacterialMutationPromoterAvailable SinceApril 10, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.1
Plasmid#222473PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 1). Variant 1 is chr10:128568698-A-G where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 1) (LOC110120928 Human)
UseLuciferaseTagsExpressionMutationVariant 1 is chr10:128568698-A-G where the inform…PromoterAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.3
Plasmid#222475PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 3). Variant 3 is chr10:128569437-G-A where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 3) (LOC110120928 Human)
UseLuciferaseTagsExpressionMutationVariant 3 is chr10:128569437-G-A where the inform…PromoterAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-hs737.2
Plasmid#222474PurposeLuciferase vector containing the hs737 enhancer sequence (sequence containing variant 2). Variant 2 is chr10:128569418-T-C where the information is chromosome:positionInB38-RefAllele-AltAllele.DepositorInserths737 enhancer sequence (sequence containing variant 2) (LOC110120928 Human)
UseLuciferaseTagsExpressionMutationVariant 2 is chr10:128569418-T-C where the inform…PromoterAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-123_HA-GD2-28z_CAR_TF_Library
Pooled Library#207478PurposeHA-GD2-28z CAR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into thDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-128_HA-GD2-28z_CAR_TFxTF_Library
Pooled Library#207480PurposeHA-GD2-28z CAR in combination with ~10,000 transcription factor combinations (and related proteins) and controls (GFP/RFP combinations). Library can be used to generate HDR templates for modular pooleDepositorUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-106_NY-ESO-1_TCR_SR_Library
Pooled Library#207474PurposeNY-ESO-1 TCR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T cellsDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-107_NY-ESO-1_TCR_TF_Library
Pooled Library#207475PurposeNY-ESO-1 TCR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into theDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-109_CD19-BBz_CAR_SR_Library
Pooled Library#207476PurposeCD19-BBz CAR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T cellsDepositorUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-110_CD19-BBz_CAR_TF_Library
Pooled Library#207477PurposeCD19-BBz CAR in combination with 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into theDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-124_HA-GD2-28z_CAR_SR_Library
Pooled Library#207479PurposeHA-GD2-28z CAR in combination with 129 surface receptors and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knockin (ModPoKI) into the TRAC locus of human T celDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
plIG-132_CD19-28z_CAR_TF_and_SR_Library
Pooled Library#207481PurposeCD19-28z CAR in combination with 129 surface receptors, 100 transcription factors (and related proteins) and 2 controls (GFP/RFP). Library can be used to generate HDR templates for modular pooled knocDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pG108 - K
Plasmid#178039PurposeBacteroides - Escherichia coli shuttle vector with TetQ and Kanamycin selection markersDepositorInsertKanamycin resistance
UseTagsExpressionBacterialMutationErmAM has been replaced with Kanamycin for select…PromoterAvailable SinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SBE4-Luc
Plasmid#16495PurposeLuciferase reporter containing four copies of the Smad binding siteDepositorInsertSmad binding element
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only