We narrowed to 55,187 results for: kan
-
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS-BsmbI-LoxP-Ef1a-EM7-mCherry-Neo-PolyA-LoxP
Plasmid#192822PurposeGolden Gate compatible plasmid with mCherry and NeoDepositorInsertmCherry and Neo
ExpressionMammalianAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG 17xS/T->A, catalytic dead lipin 1
Plasmid#32008DepositorInsertLipin1 (Lpin1 Mouse)
TagsFLAGExpressionMammalianMutationD712E, D714E AND S106A, S150A, (S281A, T282A), S2…PromoterCMV, SP6Available SinceOct. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHS0535 CRISPR-associated IscB (Chesapeake Bay) in pBR322 with Fn spacer
Plasmid#176589PurposeEndogenous locus of CRISPR-associated IscB (Chesapeake Bay) with Fn spacerDepositorInsertCRISPR-associate IscB (Chesapeake Bay) locus
ExpressionBacterialMutationTruncated CRISPR array to two direct repeats, rep…Available SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL
Plasmid#119952PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFastBac SpyTag-β2AR-SpyTag
Plasmid#135620PurposeExpression of SpyTag-B2AR in insect cellDepositorInsertBeta 2 adrenergic receptor (ADRB2 Human)
TagsHA-FLAG tag, Spytag, and eGFP-10xHis-R1D4 tagExpressionInsectMutationDeleted 1-24 aa, 366-413 aaAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-HOXD13-IDR-mCherry-CRY2-NLS
Plasmid#145260PurposeMammalian Expression of Nuclear Opto HOXD13 IDR with SV40 NLSDepositorInsertHOXD13wt-IDR (HOXA13 Human)
ExpressionMammalianAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe B5
Plasmid#197576PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe B5 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
TagsNuclear export sequence + FLAGExpressionMammalianMutationN311G, C313APromoterCMV and U6/H1Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-45b-HOXD13(+10A)-IDR-mCherry
Plasmid#145282PurposeBacterial Expression of 6xHis HOXD13 (+10A) IDR mCherry Fusion ProteinDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1397CN
Plasmid#186203PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1397C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1397N of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLAG-IRES-Blasticidin-hOCT4 WT
Plasmid#198764PurposeMammalian expression of hOCT4DepositorAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3/FKBP12-pBirA(284-C)-HA
Plasmid#154452Purposeexpresses FKBP12-pBirA(284-C)-HA/biochemical assayDepositorAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-HOXD13(+9A)-IDR-mCherry-CRY2-NLS
Plasmid#145263PurposeMammalian Expression of Nuclear Opto HOXD13(+9A) IDR with SV40 NLSDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
Plasmid#79889PurposeDonor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
ExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-HOXA13-58A-IDR
Plasmid#145238PurposeExpresses fusion of GAL4 DNA-binding domain and HOXA13-58A IDRDepositorAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIG AKT3 E17K;K177M
Plasmid#73049PurposeHuman AKT3 E17K;K177MDepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg1
Plasmid#254529PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg2
Plasmid#254530PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_AAVS1_sg3
Plasmid#254531PurposeAAVS1 knockout, control guideDepositorInsertAAVS1
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-GFPAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only