We narrowed to 18,384 results for: ids
-
Plasmid#13741DepositorAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pTR-UF11 (AAV.A07.T)
Viral Prep#157970-AAV.A07.TPurposeReady-to-use AAV2 (trpYF) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCODE
Plasmid#247473PurposePlasmid for constitutive expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operonPromoterJ23100Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hINSR-Venus1
Plasmid#248626PurposeExpression of the human INSR tagged with Venus1 for BiFCDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LYN
Plasmid#224238PurposeExpression of human LYN Kinase in E. coliDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacHTa_HCK
Plasmid#224245PurposeExpression of human HCK Kinase in insect cells (SF9 cells)DepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE mCherry-Rab11A S25N
Plasmid#228037PurposeMammalian lentiviral expression of mCherry-labeled Rab11 S25N (dominant negative mutation).DepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hSMAD4
Plasmid#212710PurposeThe ORF of human SMAD4, variant 1 cDNA amplified from the RT human liver RNA was cloned at the NheI/HindIII sites of the pcDNA3.1(+), the mammalian expression vector.DepositorAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNHA_OROV_NCP
Plasmid#208937PurposeExpresses N-terminally HA-tagged Oropouche orthobunyavirus nucleocapsid protein from CMV promoter in mammalian cellsDepositorInsertNucleocapsid
TagsHAExpressionMammalianMutationDeleted start codon so HA included at N-terminusPromoterCMVAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mSstr3-EGFP
Plasmid#200444PurposeLentiviral expression of mouse Sstr3-EGFPDepositorAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-iRFP713(V256C)-P2A-EGFP
Plasmid#198071PurposeThe AAV vector for iRFP713(V256C) and EGFPDepositorInsertiRFP713(V256C)
UseAAVTagsP2A-EGFPMutationV256C mutationPromoterCMVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
IDG_CLCN6_OE_1
Plasmid#161664PurposeOverexpresses CLCN6DepositorAvailable SinceAug. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
Lentiviral-KOR-FRB
Plasmid#191496PurposeRapamycin-dependent opioid sensor for the kappa opioid receptor (component 1)DepositorInsertKOR-FRB
UseLentiviralPromoterCMVAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Pom121 mApple
Plasmid#187674PurposeIn vivo visualization of NPC protein Pom121DepositorAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-NES-jGCaMP8m-WPRE
Plasmid#186045PurposeAAV-mediated cytosolic expression of jGCaMP8m under the CAG promoter, Cre-dependent expressionDepositorInsertNES-jGCaMP8m
UseAAVTagsNES-6xHisExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-NES-jGCaMP8s-WPRE
Plasmid#186046PurposeAAV-mediated cytosolic expression of jGCaMP8s under the CAG promoter, Cre-dependent expressionDepositorInsertNES-jGCaMP8s
UseAAVTagsNES-6xHisExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLEX-NES-jGCaMP8f-WPRE
Plasmid#186044PurposeAAV-mediated cytosolic expression of jGCaMP8f under the CAG promoter, Cre-dependent expressionDepositorInsertNES-jGCaMP8f
UseAAVTagsNES-6xHisExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only