We narrowed to 18,351 results for: multi
-
Viral prep#157970-AAV.A11.TPurposeReady-to-use AAV44.9 in PBS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAAVS1-Neo-UBC-M2rtTA-H2BmNeon (donorAB-UBC-mNeon)
Plasmid#85800PurposedonorAB-UBC-Neon targeting vector for human AAVS1 locus; knock-in of Dox controlled H2BneonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPPP1R12C (PPP1R12C Human)
UseHuman targetingMutationhomology arms for knock-in into first intronAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGem-nHyPer:sAPX
Plasmid#84735PurposeSimultaneous expresion of stromal HyPer2 and stromal Ascorbate peroxidase (APX) in plant cellsDepositorInsertsTagsnuclear localisation signals from the coding sequ…ExpressionPlantPromoterFMV/35SAvailable sinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A06.T)
Viral prep#157970-AAV.A06.TPurposeReady-to-use AAV2 (trpYF) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable sinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_Gap43_Csx30_Cre
Plasmid#197604PurposeCre reporter for mammalian cells with Gap43 membrane anchorDepositorInsertGap43_Csx30_Cre
ExpressionMammalianAvailable sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_Chrm3_Csx30_Cre
Plasmid#197603PurposeCre reporter for mammalian cells with Chrm3 membrane anchorDepositorInsertChrm3_Csx30_Cre
ExpressionMammalianAvailable sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRS1005
Plasmid#247641PurposeConstitutive CRISPRa-HyperdCas12a for Candida albicansDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKDM
Plasmid#110740PurposePlasmid for the insect cell expression system, two promoters, Multiplication Module M, Tn7 transpositionDepositorTypeEmpty backboneExpressionInsectAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ147
Plasmid#69299PurposeGolden Gate recipient and Gateway entry vector; assembly of 7 gRNAsDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS5321-CRISPRai-Markerless
Plasmid#182828PurposeSaccharomyces cerevisiae inducible CRISPRai vector - markerlessDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQLinkHD_mVenus
Plasmid#118861Purposefluorescent protein expression with an N-terminal His-tagDepositorInsertmVenus
TagsHis-tagExpressionBacterialAvailable sinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EZH2_N_FS_v2_Donor
Plasmid#79901PurposeN-terminal tagging of human EZH2 with 3xFLAG_Twin_StrepDepositorTypeEmpty backboneUseCRISPR and TALENTags3xFLAG_Twin_StrepAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYTK036
Plasmid#65143PurposeEncodes Cas9 as a Type 3 part to be used in the Dueber YTK systemDepositorPublicationInsertCas9
ExpressionBacterialAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICH50927
Plasmid#48049DepositorTypeEmpty backboneUseUnspecifiedAvailable sinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pAS164
Plasmid#194487Purpose92-1 Op (Part 2)DepositorInsert92-1 Op (Part 2)
UseSynthetic BiologyAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ138A
Plasmid#69280PurposeGolden Gate entry vector; 8th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ137A
Plasmid#69279PurposeGolden Gate entry vector;7th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
Plasmid#163643PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.DepositorInsertsUseLentiviralTagsLuc2-P2A-tdTomato-T2AMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterEFS and pU6Available sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only