We narrowed to 28,618 results for: ung
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-WT
Plasmid#136008PurposeWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pCCL-NoPromoter-FLuc-CMV-RLuc-dsRed2
Plasmid#215329PurposeLentiviral mammalian vector with firefly luciferase gene with no upstream promoter sequence; renilla luciferase and dsRed2 reporter under CMV promoter.DepositorInsertNo Promoter
UseLentiviral and LuciferaseExpressionMammalianAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC332
Plasmid#87845PurposeAMA1 plasmid with Aspergillus optimized Cas9 and hph selection markerDepositorInsertsCas9
hph (hygromycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGIPz-mPD-L1
Plasmid#121488PurposeExpression of mouse PD-L1 WTDepositorInsertPD-L1
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCH61 (multiAsCas12a-KRAB piggyBac)
Plasmid#217332PurposepiggyBac expression of multiAsCas12a-KRABDepositorInsertmultiAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2ExpressionMammalianMutationR1226A/E174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD099
Plasmid#212923PurposeA MoClo Yeast Toolkit LEU2, CEN/ARS empty vector (GFP dropout). Contains ConL1, part234 GFP dropout, ConR2, LEU2, CEN6/ARS4, AmpR-ColE1.DepositorInsertGFP
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD300
Plasmid#212930PurposeEncodes the S. cerevisiae Aga1 protein (Part3) with pGBK1 promoter, tENO2 terminator, HIS3 selectable marker and CEN/ARS yeast origin.DepositorInsertAGA1 (AGA1 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD153
Plasmid#212929PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the 111AA SCW4 TFP (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD141
Plasmid#212928PurposeEncodes the mRuby2 fluorescent protein (Part3b') with the Aga2 signal peptide (Part3a') assembled with S. cerevisiae pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertmRuby2
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD080
Plasmid#212917PurposeEncodes the S. cerevisiae Aga1p yeast surface display anchor protein as a Type 3 part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA1 (AGA1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD083
Plasmid#212920PurposeEncodes the HA-tagged S. cerevisiae Sed1p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertSED1 (SED1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD003
Plasmid#212900PurposeEncodes S.cerevisiae ECM14 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertECM14 (ECM14 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD023
Plasmid#212909PurposeEncodes a hybrid S. cerevisiae OST1 pre- MFalpha1 pro- signal peptide (OST1MFapp) as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertMFalpha1 (MF(ALPHA)1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD081
Plasmid#212918PurposeEncodes the HA-tagged S. cerevisiae Aga2p yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertAGA2 (AGA2 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD005
Plasmid#212902PurposeEncodes S. cerevisiae KSH1 pre- signal peptide as a Type 3a' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertKSH1 (KSH1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag p21 WT
Plasmid#16240DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
Tag5Amyc-GSK3b CA
Plasmid#16261DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only