We narrowed to 81,743 results for: MYC;
-
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hZMPSTE24-3FLAG_pQCXIP
Plasmid#89759PurposeHuman ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.DepositorInsertHomo sapiens zinc metallopeptidase STE24 (ZMPSTE24) (ZMPSTE24 Human)
UseRetroviral; Bicistronic expression: puromycin re…Tags9bp spacer (NotI site) - 3xFLAG epitopes - Stop c…ExpressionMammalianMutationY253H in ZMPSTE24 (see depositor comments below)PromoterCMVAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-dCas9-KRAB-PGK-HygR
Plasmid#83890PurposeLentiviral Sp dCas9-KRAB fusion with Hygromycin B resistance cassette.DepositorInsertshumanized dead Cas9 KRAB
aminoglycoside phosphotransferase from E. coli
UseCRISPR and LentiviralTagsFlagMutationD10A and H840APromoterHuman Ubiquitin C Promoter and mouse phosphoglyce…Available SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-AktAR2
Plasmid#64933PurposeLysosome-targeted FRET biosensor for monitoring Akt activity; targeted to cytosolic face of lysosomal membrane.DepositorInsertLAMP1-AktAR2 (LAMP1 Budding Yeast, Human, Synthetic)
TagsCerulean3, Full-length LAMP1, and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5465_pHR_hU6-crScaffold_EF1a-PuroR-T2A-BFP
Plasmid#155307PurposeRfx Cas13d guide cloning lentiviral vector with constitutively expressed puromycin resistance 2A-tagged with tagBFPDepositorInsertRfx Cas13d CRISPR RNA puromycin resistance 2A-tagged BFP
UseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT8-V5H6.MCh.Puro
Plasmid#209947PurposeIn mammalian cells expresses TP fused to a CNOT8 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 8 (CNOT8 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dronpa-FHA1
Plasmid#87711PurposeEncodes N-terminal (PAABD) fragment of bimolecular super-resolution PKA activity reporter (bimFLINC-AKAR).DepositorInsertDronpa-FHA1
Tags6xHis, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3e UbB polyA
Plasmid#188702PurposeGateway 3' element encoding the ubiquitin B polyadenylation sequenceDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1821
Plasmid#163092PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet^SEC (Lox511I)^::3xMyc
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p28-2iDP-puro
Plasmid#88893PurposeDual-intron DMD platform plasmid. Co-expresses DMD platform segment, firefly luciferase, puroR and mCherry. Plasmid carries phiC31 and Bxb1 attB sites.DepositorInsertsDual-intron DMD platform
luciferase
puromycin resistance enzyme
mCherry
ExpressionMammalianMutationTruncated version of the dystrophin protein (tran…Available SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-HA
Plasmid#162100PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-HA
Plasmid#162103PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-HA
UseLentiviralTagsVSVg-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-HA-FLAG
Plasmid#162106PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-HA-FLAG
UseLentiviralTagsVSVg-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-ProtC-AU1
Plasmid#162111PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-ProtC-AU1
UseLentiviralTagsStrepTagII-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-HA-AU1
Plasmid#162116PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-HA-AU1
UseLentiviralTagsProtC-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-HA-AU1
Plasmid#162087PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-HA-AU1
UseLentiviralTagsVSVg-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-ProtC-FLAG
Plasmid#162090PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-FLAG
UseLentiviralTagsStrepTagII-ProtC-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only