We narrowed to 821 results for: mRuby
-
Plasmid#183888PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and TUBA1B sgRNA for N-terminal tagging of alpha-tubulin in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only
-
ARB366
Plasmid#124049PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to KRAB domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::KRAB-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-RHOA_sgRNA
Plasmid#183877PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSET-RCaMP1h
Plasmid#42874Purposea single-wavelength red-shifted genetically encoded calcium indicator constructed from calmodulin and cp-mRubyDepositorInsertRed Fluorescent Calcium binding Protein
TagsEK (Enterokinase) Recognition Site, His Tag (6x),…ExpressionBacterialPromoterT7Available SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianPromoterEF1aAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-ICUE
Plasmid#181845PurposeGenetically encoded FRET-based sensor for monitoring cAMP dynamics near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKS1575
Plasmid#239523PurposeExpress Vba2p membrane protein cargo fused directly to Pex22 TMD, peroxisomal Ynd1p truncation, and peroxisomal mRuby2DepositorInsertScPex22(1-36)-ScVba2p-mTurquoise2-2xCrk_SH3
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKS1613
Plasmid#239531PurposeExpress CpPT1 membrane protein cargo fused to PTS1 and Pex22(1-36)-mRuby2; chromosomal integration by CRISPRDepositorInsertmTurquoise2-CpPT1(52-408)-SKL
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKS1574
Plasmid#239522PurposeExpress Yea4p membrane protein cargo fused directly to Pex22 TMD, peroxisomal Ynd1p truncation, and peroxisomal mRuby2DepositorInsertScPex22(1-36)-ScYea4p-mTurquoise2
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVL1337
Plasmid#239541PurposeExpress Yea4p membrane protein cargo fused directly to Pex15 TMD, peroxisomal Ynd1p truncation, and peroxisomal mRuby2DepositorInsertScYea4p-mTurquoise2-ScPex15(315-383)
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKS1612
Plasmid#239530PurposeExpress CpPT1 membrane protein cargo without mTurqoise2 marker fused to PTS1 and Pex22(1-36)-mRuby2; chromosomal integration by CRISPRDepositorInsertCpPT1(52-408)-SKL
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVL1279
Plasmid#239538PurposeExpress CDT1 membrane protein cargo fused directly to Pex22 TMD, peroxisomal Ynd1p truncation, and peroxisomal mRuby2DepositorInsertScPex22(1-36)-NcCDT1-mTurquoise2-2xCrk_SH3
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLNL1135
Plasmid#160866PurposePJ23110-RBS-CAT-taa-mRuby2-tL3S2P24_KanR_p15ADepositorInsertChloramphenicol Acetyltransferase
UseSynthetic BiologyExpressionBacterialPromoterPJ23110_BBa_B0029Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only