We narrowed to 844 results for: mRuby
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pJJB1338
Plasmid#218592PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTS2339_Tier3(SB)-Ruby_Puro
Plasmid#169637PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven mRuby2 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2354_Tier3(PB)-Ruby_PuroR
Plasmid#169653PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a mRuby2 marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-mRuby2-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven mRuby2 and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSWD95D293A
Plasmid#159099PurposeCckA FRET Sensor with DITE motif mutantDepositorInsertCckA 1-182, Linker SNVTRHRSATE, mClover3, CckA 183-691 (D293A), Linker SNVTRHRSAT, mRuby3
ExpressionBacterialMutationCckA D293 mutated to A293 and V199I on mRuby3 (P…PromoterXyloseAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSJD001
Plasmid#158589PurposePex22(1-36)-mRuby2 peroxisome markerDepositorInsertPex22(1-36)-mRuby2
ExpressionYeastAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGD253
Plasmid#132374Purposecontains the sequence of mRuby2 for C-term fusions in the pGGD000 backbone (GreenGate)DepositorInsertmRuby2
UseGreengate entry plasmidAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYTK046
Plasmid#65153PurposeEncodes mRuby2 as a Type 3b part to be used in the Dueber YTK systemDepositorInsertmRuby2
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
TagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
ARB343
Plasmid#124026PurposeEncodes TU with connectors LS R1 and an A4 insulator, and pEF1a expressing nuclear mRuby2DepositorInsertLS-A4_EF1a-NLS::mRuby2-bgPA_R1
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB351
Plasmid#124034PurposeEncodes TU with connectors L2 R3 and an C3 insulator, and pCAG expressing membrane-tagged mRuby2DepositorInsertL2-C3_CAG-Lyn::mRuby2-SV40_RE
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_030
Plasmid#123969PurposeEncodes the phiC31-hygromycin-mRuby2PEST landing pad as a type 0 part to be used in the MTK systemDepositorInsertphiC31-hygro-mRuby2PEST landing
ExpressionMammalianAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
FNL Combinatorial Cloning Platform
Plasmid Kit#1000000211PurposeA Frederick National Laboratory (FNL) combinatorial cloning set to generate many tagged expression clones in parallel for protein production, in vivo gene expression, and shRNA and CRISPR delivery.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeBacterial Expression, Insect Expression, Mammalian ExpressionCloning TypeMultiSite GatewayAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLSPR24
Plasmid#217309PurposePromoterless (SwaI Cutsite) mRuby3:amdS fusion reporterDepositorInsertAcetamidase
TagsmRuby3ExpressionYeastAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSPR30
Plasmid#217315PurposeGAL7(p)-mRuby3:amdS fusion reporterDepositorInsertAcetamidase
TagsmRuby3ExpressionYeastPromoterGAL7Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSPR31
Plasmid#217316PurposeTEF1(p)-mRuby3:amdS fusion reporterDepositorInsertAcetamidase
TagsmRuby3ExpressionYeastPromoterTEF1Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD063
Plasmid#212916PurposeEncodes mRuby2 fluorescent protein as a Type 3b' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertmRuby2
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM0624
Plasmid#128999PurposepZF(3BS)-mRUBY2 cassette plasmid flanked by ConL2 and ConREDepositorInsertConL2-pZF(BS)-mRUBY2-tADH1-ConRE AmpR-ColE1
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLNL1130
Plasmid#160861PurposePJ23110-RBS-AbWS/DGAT-mRuby2-tL3S2P24_KanR_p15ADepositorInsertO-acyltransferase WSD
UseSynthetic BiologyTagsmRuby2ExpressionBacterialPromoterPJ23110Available SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only