We narrowed to 11,442 results for: nar
-
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAJE3-E7
Plasmid#214359PurposeExpresses the 2nd-generation "E7" Tet2 Methanocaldococcus jannaschii (Mj) aminoacyl tRNA synthetase/tRNA pair for encoding Tet2 noncanonical amino acids into TAG sites of proteinsDepositorInserts2nd generation Tet2 "E7" aminoacyl tRNA synthetase
Lpp promoted M. jannaschii tRNA
Aminoglycoside-3''-adenyltransferase (Spectinomycin/streptomycin Resistance Gene)
Orthogonal "D4II" ColE1 origin
ExpressionBacterialPromoterAmpR and lppAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLAG-BACH2
Plasmid#232275PurposeExpression of FLAG-tagged BACH2 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE
Plasmid#162376PurposeAAV-mediated expression of ultrafast protein calcium sensor under the Syn promoterDepositorHas ServiceAAV Retrograde, AAV1, AAV5, and AAV9InsertjGCaMP8f
UseAAVTags6xHisExpressionMammalianMutationQ315LPromoterSynapsinAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX MLKL(wt)--2A-mCherry-puro
Plasmid#231974PurposeTet inducible expression of DmrB-Mlkl with mCherry to induce WT Mlkl expressionDepositorAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FBXL17
Plasmid#236188PurposeExpression of N-terminal tagged FLAG-FBXL17 (H. sapiens, codon-optimized) in human cell lines.DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB-GST-FBXO22
Plasmid#228367Purposeexpress human FBXO22 in insect cells, such as Trichoplusia ni Hi5DepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-His-SKP1
Plasmid#228368Purposeexpress human SKP1 in insect cells, such as Trichoplusia ni Hi5DepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FBXO22
Plasmid#232271PurposeExpression of N-terminal tagged HA-FBXO22 (H. sapiens) in human cell linesDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMK262 (RAD21-mAC Neo)
Plasmid#140538PurposeRAD21 tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
anti-GFP scFv [N86/38] with sortase tag
Plasmid#204419PurposeMammalian Expression of anti-GFP scFv with a sortase tag for direct dye conjugation. Derived from hybridoma N86/38.DepositorInsertRecombinant mouse scFv targeting GFP (Aequorea victoria)
Tags6xHis tag and Sortase tagExpressionMammalianAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Hygro)
Plasmid#140646PurposeCTCF tagging with mAID-cloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-2
Plasmid#184481PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT1-1
Plasmid#184480PurposeLentivirus gRNA targeting human LIPT1 geneDepositorInsertLIPT1 (LIPT1 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CTCF-mAC donor (Neo)
Plasmid#140645PurposeCTCF tagging with mAID-CloverDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only