We narrowed to 14,259 results for: crispr grnas
-
-
-
-
-
-
-
pSC32
Plasmid#104806PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101090 (Pen3). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr2g101090
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC31
Plasmid#104805PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101090 (Pen3). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr2g101090
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC27
Plasmid#104801PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g020620 (Pho2ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g020620
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC26
Plasmid#104800PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101040 (Mel1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertMedtr2g101040
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC20
Plasmid#104794PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g020630 (FmoI). Also expresses Cas9 from AtUBQ10 promoterDepositorInsertMedtr2g020630
UseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC14
Plasmid#104788PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from AtUBQ10 promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC15
Plasmid#104789PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from rolD promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC13
Plasmid#104787PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr2g044580
UseCRISPRExpressionPlantAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor_sU6
Plasmid#69351PurposesgRNA scaffold and synthetic U6 promoterDepositorInsertsU6 promoter and sgRNA scaffold flanked by BbsI sites
UseCRISPRPromotersynthetic U6 promoterAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pV1090
Plasmid#111427PurposegRNA entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at RPS1 (Part of Duet system)DepositorInsertsgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g3
Plasmid#153013PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing mCherryDepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-Esp3I-mU6-Kan
Plasmid#213015PurposeVector for Cloning of multiple gRNAs driven by distinct promoters (H1 and mU6)DepositorInsertH1 promoter, mU6 promoter, gRNA scaffolds
PromoterH1 promoterAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only
