We narrowed to 13,565 results for: CAN
-
Plasmid#138313PurposeLenti expression of AcrIIA15DepositorInsertAcrIIA15
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF525-AcrIIA14_gb77_Cand9_lenti
Plasmid#138311PurposeLenti expression of AcrIIA14DepositorInsertAcrIIA14
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3_ctrl_CP-candidate_luc+
Plasmid#86392PurposeLuciferase validation vector, where candidates are inserted at the position of the core promoter. The candidates basal activity (no enhancer in vector) is reflected by luciferase activityDepositorTypeEmpty backboneUseLuciferaseTagsExpressionMutationPromoterAvailable sinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2/V5 cand181
Plasmid#26323DepositorInsertcand181
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-4
Plasmid#184730PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-3
Plasmid#184727PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-4
Plasmid#184728PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-3
Plasmid#184729PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
UseTagsExpressionMammalianMutationChanged Valine 337 to MethinoninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12K317M
Plasmid#194164PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau K317M mutation. Expresses the tau circRNA 12-->10 K317M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT (MAPT Human)
UseTags3X FlagExpressionMammalianMutationChanged Lysine 317 to MethioninePromoterAvailable sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZSCAN18-donor
Plasmid#113821PurposeCRISPR donor plasmid to tag human transcription factor ZSCAN18 with GFPDepositorInsertZSCAN18 homology arms flanking EGFP-IRES-Neo cassette (ZSCAN18 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZSCAN18.1.0-gDNA
Plasmid#113789PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZSCAN18DepositorInsertZSCAN18 (ZSCAN18 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZKSCAN4.1.0-gDNA
Plasmid#112465PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZKSCAN4DepositorInsertZKSCAN4 (ZKSCAN4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZSCAN9.1.0-gDNA
Plasmid#112440PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF193DepositorInsertZNF193 (ZNF193 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZKSCAN8.1.0-gDNA
Plasmid#112430PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF192DepositorInsertZNF192 (ZNF192 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZSCAN32.1.0-gDNA
Plasmid#112400PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF434DepositorInsertZNF434 (ZSCAN32 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZKSCAN4-donor
Plasmid#112369PurposeCRISPR donor plasmid to tag human transcription factor ZKSCAN4 with GFPDepositorInsertZKSCAN4 homology arms flanking EGFP-IRES-Neo cassette (ZKSCAN4 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZSCAN32-donor
Plasmid#112304PurposeCRISPR donor plasmid to tag human transcription factor ZNF434 with GFPDepositorInsertZNF434 homology arms flanking EGFP-IRES-Neo cassette (ZSCAN32 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3_zfh1_CP-candidate_luc+
Plasmid#86391PurposeLuciferase validation vector, where candidates are inserted at the position of the core promoter. The candidates responsiveness to the upstream enhancer is reflected by luciferase activityDepositorInsertD. melanogaster zfh1 enhancer
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only