We narrowed to 70 results for: Tfg
-
Plasmid#196694PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmEGFP and mtagBFP2ExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsAP, Avitag and HAExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Zebrafish, Human)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Nematode, Human)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-EREG-ScNeo
Plasmid#209915PurposeTo express the chimeric protein of TGFα and EREG, which a recombinant TGFα protein fused extracellularly to the mScarlet and a recombinant Epiregulin protein fused intracellularly to the mNeonGreenDepositorTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#226376-rAbPurposeAnti-APP (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistryReactivityHuman and MouseSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits