Targeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using puromycine selection. Auxin-inducible degron system.

Targeting vector to introduce an AID-eGFP cassette at the mouse RAD21 (SCC1) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA CCACGGTTCCATATTATCTG

Unfused click editor construct expressing mSA-ePhi29(D169A), expressed from CMV or T7 promoters.

Unfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.

Unfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.

Targeting vector to introduce an AID-eGFP cassette at the mouse WAPL locus using Neomycin/Kanamycin selection. Auxin-inducible degron system.

Unfused click editor construct expressing mSA-EcKlenow, expressed from CMV or T7 promoters.

Expresses human LINE-1 ORF2 only in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2

Ready-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-JRGECO1a (#128317). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-JRGECO1a plasmid DNA. EF1a-driven, Flp-dependent expression of the biosensor jRGECO1a. These AAV preparations are suitable purity for injection into animals.

pGL0_151 [RS421] is a library of broad host range prokaryotic promoters-RBS regulatory sequences formatted as a golden gate assembly Level 0 part.

Ready-to-use AAV1 particles produced from pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 (#98928). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.Ruby2sm-Flag.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent expression of Ruby2sm-Flag spaghetti monster construct. Spaghetti monster constructs are not fluorescent ("dark") to allow full range of antibody staining. These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV1 particles produced from pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 (#98927). In addition to the viral particles, you will also receive purified pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent expression of GFPsm_myc spaghetti monster construct. Spaghetti monster constructs are not fluorescent ("dark") to allow full range of antibody staining. These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV2 particles produced from pAAV-CBh-mKate2-IRES-MCS (WT-WT) (#105921). In addition to the viral particles, you will also receive purified pAAV-CBh-mKate2-IRES-MCS (WT-WT) plasmid DNA. Control mKate2 expression AAV with two wild-type ITR sequences. These AAV preparations are suitable purity for injection into animals.

pre-associated oBC-mBC backbone (p025), can insert additional reporter constructs

68 His-tagged human kinase catalytic domain constructs and the respective phosphatases that enhance their bacterial expression; optimized for automated bacterial expression

Ready-to-use AAV9 particles produced from AAV-EF1a-BbChT (#45186). In addition to the viral particles, you will also receive purified AAV-EF1a-BbChT plasmid DNA. Brainbow construct encoding mCherry and mTFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.

Ready-to-use AAV9 particles produced from AAV-EF1a-BbTagBY (#45185). In addition to the viral particles, you will also receive purified AAV-EF1a-BbTagBY plasmid DNA. Brainbow construct encoding farnesylated TagBFP and EYFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.

AAV construct used as a cell filler to label neurons with tdTomato

AAV construct used as a cell filler to label neurons with mTurquoise2