We narrowed to 10,272 results for: tre promoter
-
Plasmid#213684PurposeExpresses human granulin-4 with an N-terminal twin-Strep-FLAG tagDepositorInsertHuman granulin-4 (hGRN4) (GRN Human)
UseAAVTagsTwin-Strep tag and FLAG tag (after signal peptide…Promotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDR111_mannose_Stat1Klf6
Plasmid#188400PurposeExpresses mouse transcription factors Stat-1 and Klf6 in an operon from D-mannose promoter for Bacillus subtilis. The secretion peptide PhoD is fused to both factors.DepositorTagsPhoD secretion peptideExpressionBacterialPromoterD-mannoseAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS2230
Plasmid#158420PurposeAAV plasmid with Ple253 (PITX3 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2177
Plasmid#111892PurposeHigh copy number plasmid containing Ple344 (TUBB3 MiniPromoter) insert.DepositorAvailable SinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2175
Plasmid#111890PurposeHigh copy number plasmid containing Ple342 (TUBB3 MiniPromoter) insert.DepositorAvailable SinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2176
Plasmid#111891PurposeHigh copy number plasmid containing Ple343 (TUBB3 MiniPromoter) insert.DepositorAvailable SinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2236
Plasmid#111889PurposeHigh copy number plasmid containing Ple321 (TUBB3 MiniPromoter) insert.DepositorAvailable SinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
FUW-tetO-YAPS94A
Plasmid#84010Purposeexpresses a TEAD-binding mutant of YAP (YAPS94A) in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationS94APromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SNF5
Plasmid#109186PurposePlasmid for expression of C-terminally 3xFLAG-tagged SNF5 under the control of a polh promoter in baculovirus/insect cell systemsDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GST-BcPC-PLC
Plasmid#224255PurposeExpress N-terminal HRV 3C protease cleavable GST fused to Bacillus cereus PC-PLC in E.coliDepositorTagsGST and HRV-3C (LEVLFQGP) siteExpressionBacterialMutationThe gene of Bacillus cereus ATCC 14579 was used f…Promoterlac promoterAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RHO-IntC-dCas9C-VPR-polyA
Plasmid#166692PurposeExpress C-terminal part of split dCas9-VPRDepositorInsertIntC-dCas9C-VPR
UseAAV and CRISPRExpressionMammalianPromotershort human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA228-pro4IUPi
Plasmid#122018PurposeExpresses IUP pathway genes (ChK, IPK, idi) under constitutive promoter. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpro4Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-V82G (pJUL1828)
Plasmid#131313PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).DepositorInsertbpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11060
Plasmid#68264PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)DepositorInsertPromoter/5UTR: CsVMV+ CDS:SpCas9 + 3UTR/terminator:35s
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC-BAR-YR
Plasmid#61766PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing bar gene (for resistance against glufosinate ammonium) on transfer DNA (TDNA).DepositorInsertsBar gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromotertrpC promoterAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LITE2.0_pAAV_hSyn_TALE(Grm2)-GS-CIB1(NLS*,∆318-334)_WPRE_bGHpA
Plasmid#47456PurposeLITE2.0 TALE-CIB1. Changes from LITE1.0: glycine-serine linker, mutated endogenous NLS, aa318-334 deletion. This particular TALE targeted to Grm2. Synapsin promoter for neuronal expression.DepositorInsertTALE(Grm2)-GS-CIB1(NLS*,∆318-334)
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTET-IUPi
Plasmid#122019PurposeExpresses IUP pathway genes (ChK, IPK, idi) under inducible promoter. aTC inducible. Kan. resist.DepositorInsertsExpressionBacterialMutationCodon optimized for E. coliPromoterpTETAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only