We narrowed to 25,620 results for: CRISPR-Cas9
-
Plasmid#86992PurposeCRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1DepositorInsertgRNA targeting pil1
ExpressionYeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
EKv408(Gold Cas-guide insert4)
Plasmid#248337PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv407(Gold Cas-guide insert3)
Plasmid#248336PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv406(Gold Cas-guide insert2)
Plasmid#248335PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv410(Gold Cas-guide insert6)
Plasmid#248339PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv411(Gold Cas-guide insert7)
Plasmid#248340PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv412(Gold Cas-guide insert8)
Plasmid#248341PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv405(Gold Cas-guide insert1)
Plasmid#248334PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv409(Gold Cas-guide insert5)
Plasmid#248338PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSP469
Plasmid#65771PurposeHuman expression vector for SpCas9 VQR variant: CMV-T7-humanSpCas9(D1135V/R1335Q/T1337R)-NLS-3xFLAG (VQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP680
Plasmid#65772PurposeHuman expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E, R1335Q, and T1337R mutations in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV1064
Plasmid#247972PurposeCRISPR-Cas9 vector containing two 20 nt protospacer sequences to target the gene wA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-wA-gRNA 1 & 2-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
DS-SPcas
Plasmid#48645PurposeBacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycinDepositorInsertsCas9
tracrRNA precursor
UseCRISPRPromoterproC and tracrRNA promoterAvailable SinceDec. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-ST1cas
Plasmid#48669PurposeMammalian S. thermophilus #1 Cas9 expression, human optimizedDepositorInsertCas9
UseCRISPRTagsNLSPromoterCMVAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-NMcas
Plasmid#48670PurposeMammalian N. meningitidis Cas9 expression, human optimizedDepositorInsertCas9
UseCRISPRTagsNLSPromoterCMVAvailable SinceJan. 9, 2014AvailabilityAcademic Institutions and Nonprofits only