We narrowed to 16,812 results for: SHR;
-
Plasmid#199274PurposepegRNA used to correct GBA (c. 1226 A > G) mutationDepositorInsertGBA 1226GtoA pegRNA
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTlpA_mCherry_YafQ/DinJ
Plasmid#229148PurposeToxin-Antitoxin (Dinj/YafQ)DepositorInsertmCherry, DinJ/YafQ
ExpressionBacterialPromoterPtlpA (mCherry), DinJ/YafQ (Native)Available SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMM135
Plasmid#127216PurposeBeYDV replicon with constitutive Luc expression, WUS2, sgRNA targeting PDSDepositorInsertLuc, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC3
Plasmid#183299PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC3 geneDepositorInsertHDAC3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT1
Plasmid#183282PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT1 geneDepositorInsertDNMT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB6633
Plasmid#106162PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6677 into Yarrowia lipolytica chromosomal location IntE_1, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMM131
Plasmid#127214PurposeBeYDV replicon with constitutive Luc expression, AtSTM, sgRNA targeting PDSDepositorInsertLuc, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR152
Plasmid#196280PurposeCassette used in dual sgRNA library generationDepositorInserthU6-sgRNA-CR3
UseCRISPR and LentiviralPromoterhU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyC-GFP
Plasmid#220191PurposesgRNA expression vector - pBG42 promoter with GFP in sgRNA siteDepositorInsertpBG42 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG42Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV/MASC_(GLuc)_TOP1
Plasmid#68439PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. CMV/MASC expression backbone.DepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM136
Plasmid#127217PurposeBeYDV replicon with constitutive Luc expression, MP-delta, sgRNA targeting PDSDepositorInsertLuc, MP-delta, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shscramble
Plasmid#71384PurposeExpresses dsRed and scramble shRNA under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shscramble
UseLentiviral and RNAiExpressionMammalianPromoterCMV enhancer/promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0051-W85X REPAIR targeting guide cloned into pC0043
Plasmid#103867PurposeGuide RNA expression plasmid for dPspCas13b that can be used to direct ADAR deaminase domain activity to the W85X mutation in the luciferase reporter plasmid pC0038DepositorInsertW85X targeting guide RNA
UseCRISPRExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PDGFRB
Plasmid#183314PurposeAll-in-One CRISPRko system with a guide RNA that targets PDGFRB geneDepositorInsertPDGFRB
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only