We narrowed to 10,153 results for: tre promoter
-
Plasmid#170445PurposeLentiviral vector expressing human SNCA, under control of EF1alpha promoter.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only
-
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Synthetic, Mouse)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5-blast
Plasmid#208381Purposelentiviral vector for expressing human B3GALT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnucleotide change in PAM targeting sequence nt 51…PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
Exp-pcDNA3.2delCMV(EF1α-tTA/TetO-mCh-Rs1)
Plasmid#26797PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Expresses tTA under EF1α promoter separately.DepositorInsertsTagsmCherry-P2AExpressionMammalianMutationD100APromoterEF1α and short TetO, miniCMVAvailable SinceFeb. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF-HA
Plasmid#195517PurposeExpresses HA-tagged CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsHA-tag and NGF signal peptideExpressionMammalianPromoterUbC promoter with beta-globin intronAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
synapsin-hIRβ-mCherry
Plasmid#228449PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) with mCherry in rat primary hippocampal neuronsDepositorInserthuman Insulin Receptor beta subunit (INSR Human)
UseAAVPromoterneuron-specific synapsin promoteAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC
Plasmid#179841Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC)ExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-iChloC
Plasmid#179842Purposedonor plasmid for cardiac-specific CCND2-T2A-iChloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagsimproved chloride-conducting ChR (iChloC)ExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-luciferase
Plasmid#179844Purposedonor plasmid for cardiac-specific CCND2-T2A-luciferase expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR, Luciferase, and TALEN ; Donor plasmidTagsluciferaseExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Hygro
Plasmid#186668PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, hygromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Hygromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA K162M-mTurq2
Plasmid#157769PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and shadowGExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA K162M-mTurq2
Plasmid#157771PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and shadowYExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only