We narrowed to 16,431 results for: LEA
-
Plasmid#235089PurposeSRSF1 mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pINTO-N3::hTET3 HxD
Plasmid#136365PurposeExpresses epitope-tagged human TET3 catalytically dead (HxD mutation) in mammalian cellsDepositorInsertTET3 (TET3 Human)
Tags2xStrepTagII, FLAG, and HAExpressionMammalianMutationHxD (H1077Y, D1079A)Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41E
Plasmid#186748PurposeExpresses S41E phosphomimetic GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP-N1-Cofilin-S41A
Plasmid#186749PurposeExpresses S41A phosphodead GFP-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsGFPExpressionMammalianMutationChanged serine 41 to alaninePromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-Cofilin-S41E
Plasmid#186751PurposeExpresses S41E phosphomimetic mCherry-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
TagsmCherryExpressionMammalianMutationChanged serine 41 to glutamic acidPromoterCMVAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaRS/Cyclin K
Plasmid#231744PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(delta104-380)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TO/CMV-puro-DD-PAmCherry1-KRas G12D
Plasmid#177320PurposeLentiviral vector expressing PAmCherry1-tagged KRas 4B G12D mutant, with an N-terminal dimerization domain (DD).DepositorInsertKRAS 4B (KRAS Human)
UseLentiviralTagsFKBP-derived dimerization domain (DD, or DmrB) an…ExpressionMammalianMutationG12DPromoterTetOn-CMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGF13A
Plasmid#220793PurposeTo express the human FGF13 isoform 1(FGF13A) in mammalian cells together with EGFPDepositorInsertFGF13 (FGF13 Human)
Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only