We narrowed to 54,929 results for: GFP
-
Plasmid#171658PurposeQUAS fifteen base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-15-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-0-QUAS-GFP_ColE1
Plasmid#171650PurposeQUAS directly downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-0-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-5-QUAS-GFP_ColE1
Plasmid#171656PurposeQUAS five base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-5-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-0-QUAS-GFP_ColE1
Plasmid#171650PurposeQUAS directly downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-0-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-5-QUAS-GFP_ColE1
Plasmid#171656PurposeQUAS five base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-5-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SpGalpha-i
Plasmid#185568Purposeto see protein dynamicsDepositorInsertGalpha-i
UseIn vitro transcription (mrna synthesis)TagsGFP, S-TagAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SpGalpha-i
Plasmid#185568Purposeto see protein dynamicsDepositorInsertGalpha-i
UseIn vitro transcription (mrna synthesis)TagsGFP, S-TagAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt++
Plasmid#187393Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt--
Plasmid#187394Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_mCherry-GFP_ChInt--
Plasmid#187396Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt++
Plasmid#187393Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt--
Plasmid#187394Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only