We narrowed to 10,073 results for: CAG
-
Plasmid#66090Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs4
UseCRISPRExpressionWormPromoterU6Available sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP332-2
Plasmid#66089Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs4
UseCRISPRExpressionWormPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP303-3
Plasmid#66087Purposeco-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2DepositorInsertsgRNA for APs1
UseCRISPRExpressionWormPromoterU6Available sinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-GFP UGT2 (pWZ587)
Plasmid#254038PurposeExpress SpCas9 and the UGT2 gRNADepositorInsertgRNA_UGT2
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available sinceJune 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ294) AAV: U6-gRNA-EF1a-ZsGreen
Plasmid#254586PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ115) AAV: U6-gRNA-EF1a-mCherry
Plasmid#254584PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-Tn7sg
Plasmid#248694PurposesgRNA expression vector - pBG35 promoter with Tn7sg negative control sgRNADepositorInsertTn7sg
ExpressionBacterialPromoterBG35Available sinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-4803
Plasmid#249321PurposeExpresses an sgRNA to target the KanR* site on the engineered E. coli MG1655 strain and contains the Repair Template to replace the KanR* on the genome of E. coli MG1655DepositorInsertsgRNA targeting the KanR* site
ExpressionBacterialMutationN/AAvailable sinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5737
Plasmid#249326PurposeExpresses Non-targeting sgRNADepositorInsertnontargeting sgRNA
ExpressionYeastMutationN/AAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shDLD #2
Plasmid#242707PurposeshRNA knockdown human DLD geneDepositorInsertDLD (DLD Human)
UseLentiviralAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1124
Plasmid#235725PurposeExpression of human UVRAG (1-464) fused to human ATG14L BATS (413-492) in mammalian cellsDepositorInsertUVRAG(1-464) fused to ATG14L BATS domain (413-492)
ExpressionMammalianAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_REC8_cterm
Plasmid#222522PurposeCas9/sgRNA plasmid for targeting REC8DepositorPublicationInsertCas9, REC8 sgRNA (REC8 Human, Synthetic)
UseCRISPRAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gATRIP_A
Plasmid#211537PurposesgRNA-A against ATRIPDepositorInsertsgRNA ATRIP
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gRHNO1_B
Plasmid#211614PurposesgRNA-B against RhnoDepositorInsertsgRNA RHNO1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-GFP-2A-Puro-gETAA1_A
Plasmid#211539PurposesgRNA-A against ETAA1DepositorInsertsgRNA ETAA1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2911
Plasmid#161764PurposeMODULE C plasmid compatible with the Voytas Plant Genome Engineering Tool kit with an Agrobacterium promoter rolD expressing the TREX2 exonuclease.DepositorInsertrolD:TREX2
ExpressionBacterialPromoterrolDAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target1 (Mpphot)
Plasmid#186728PurposeBinary vector for CRISPR/Cas9 (target 1: Mpphot [positive control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable sinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM-60-NusA-HsTNRC6A-UBA_F
Plasmid#146267PurposeBacterial Expression of HsTNRC6A-UBADepositorInsertHsTNRC6A-UBA (TNRC6A Human)
ExpressionBacterialAvailable sinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only