We narrowed to 8,862 results for: epor
-
Plasmid#173955PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertEnhancer region 2 (S2) from EC1.35 SOX9 enhancer cluster EC1.35
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_del7
Plasmid#173979PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with tiled deletion #7
UseLuciferaseMutationTiled deletion #7PromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.25_S3
Plasmid#173957PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertEnhancer region 3 (S3) from SOX9 enhancer cluster EC1.25
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-humanEC1.45_p300peak1-2_del8
Plasmid#173980PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with tiled deletion #8
UseLuciferaseMutationTiled deletion #8PromoterSV40 promoterAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Promoter-hPE(-)-Luc
Plasmid#172004PurposeLuciferase Reporter for Human PTEN Enhancer PE - Reverse OrientationDepositorInsertHuman PE sequence (hPE)
UseLuciferaseExpressionBacterial and MammalianPromoterSV40 PromoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Promoter-mPE(-)-Luc
Plasmid#172006PurposeLuciferase Reporter for Mouse PTEN Enhancer PE - Reverse OrientationDepositorInsertMouse PE sequence (mPE)
UseLuciferaseExpressionBacterial and MammalianPromoterSV40 PromoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Promoter-mPE(+)-Luc
Plasmid#172005PurposeLuciferase Reporter for Mouse PTEN Enhancer PE - Forward OrientationDepositorInsertMouse PE sequence (mPE)
UseLuciferaseExpressionBacterial and MammalianPromoterSV40 PromoterAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ptrf-mKate2
Plasmid#128765PurposeFluorescent mKate reporter for PtrfDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-ZC3H12D_PromoterMUT
Plasmid#153067PurposeZC3H12D promoter region carrying mutations in BHLHE40 binding sites, cloned upstream of luciferase reporterDepositorInsertZC3H12D promoter region mutated in BHLHE40 binding sites (ZC3H12D Human)
UseLuciferaseExpressionMammalianMutationMutagenesis to disrupt 3 BHLHE4040 binding sites.…PromoterNoneAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisPromoterE1b min pro/b-globin intronAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Exoc7-Ex5&10
Plasmid#133303PurposeEGFP reporter sequence was removed from TLCV2 vector and two gRNAs targeting mouse Exoc7 gene were cloned into the modified TLCV2 vector.DepositorInsertExocyst complex component 7 (Exoc7 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromotermU6 promoterAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIS1 HK1
Plasmid#60794PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains HK1 3' UTR and wild-type miR-155 sitesDepositorInsertHK1 3'UTR and wild-type miR-155 binding site (HK1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mHK1
Plasmid#60795PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains HK1 3' UTR and mutated miR-155 sitesDepositorInsertHK1 3'UTR and mutated miR-155 binding site (HK1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut
Plasmid#53713PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codonDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on the stop codon of firefly luciferase …Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
FW102 OL2-62
Bacterial Strain#53735PurposeBacterial-two hybrid reporter strainDepositorBacterial ResistanceKanamycin and StreptomycinSpeciesEscherichia coliAvailable SinceJune 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iGluSnFR3.v857.PDGFR
Plasmid#178333PurposeFluorescent reporter for glutamate, third generation, variant 857. iGluSnFR3.v857DepositorInsertpAAV CAG iGluSnFR3 v857.PDGFR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and PDGFR TM DomainExpressionMammalianAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only