We narrowed to 19,000 results for: rev
-
Plasmid#207540PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG2A locus in human cellsDepositorInsertHaloTag flanked by human ATG2A locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAM72
Plasmid#227622PurposepETDuet-1 Rpn8(1-179)-precission-Strep, H6-precission-Rpn11(2-239, G77P)DepositorTagsHis-PrescissionExpressionBacterialMutation1-179 and aa 2-239, G77PPromoterT7Available SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nuc-deltaCKAR
Plasmid#222430PurposeFRET-based reporter for monitoring deltaPKC activity at the nucleus in cells.DepositorInsertNucleus delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTet-F30-Pepper aptamer-UTR1-mTurq2
Plasmid#227645PurposepTet-driven expression of F30-scaffolded Pepper aptamer and mTurquoise2 for quantifying cell-free RNA and protein synthesis. The mTurq2 has a GGGGS linker followed by a His6x tag.DepositorInsertF30-scaffolded Pepper aptamer and mTurquoise2 (codon optimized for E. coli B using IDT Codon Optimizer)
UseSynthetic BiologyAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM315 pACYC-His6-Rpn10[ΔUIM]
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Golgi-deltaCKAR
Plasmid#222428PurposeFRET-based reporter for monitoring deltaPKC activity at the Golgi in cells.DepositorInsertGolgi delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-AUG-IRES-mCherry
Plasmid#222109PurposeStart codon reporter (WT AUG)DepositorInsertGFP-IRES-mCherry
UseLentiviralAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
TagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-coSnaA-TEV-His_His-TEV-SnaC
Plasmid#225059Purposerecombinant expression of SnaA in E. coliDepositorInsertSnaA
ExpressionBacterialPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ar2
Plasmid#225220PurposeExpression androgen receptor 2 in mammalian cellsDepositorInsertandrogen receptor 2
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S Budding Yeast, SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only