We narrowed to 18,508 results for: BASE
-
Plasmid#75406PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_2]) of a polycistronic tRNA-gRNA regulated by the dicot U6-26 or U6-1 promoter (3-part multiplexing)DepositorInserttRNA-gRNA
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
SNX31-PX (1-106)
Plasmid#119110PurposeBacterial expression of human phox homology (PX) domain, SNX31-PX (1-106)DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNX27-PX (156-265)
Plasmid#119106PurposeBacterial expression of human phox homology (PX) domain, SNX27-PX (156-265)DepositorAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL3 (NT933)
Plasmid#49064PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #3 and N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL3 inserted at aa460 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogRFP (C134, JBEI-15901)
Plasmid#110146PurposeTransformation and expression of Csy4 and cogDsRed proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti PA-NL
Plasmid#113453PurposeLentiviral ProteinA-NanoLuc hybrid fusion control expression vector (for BRET and LuC normalization)DepositorInsertProteinA-NanoLuc
UseLentiviral and LuciferaseExpressionMammalianPromoterhUbCAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
ROZA-XL YF
Plasmid#64195PurposeFluorescent reporter for ZAP-70 tyrosine kinase activity- Y to F mutated control sequenceDepositorInsertROZA-XL YF
ExpressionMammalianMutationROZA-XL tyrosine phosphorylation site mutated to …PromoterCMVAvailable SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-Puro
Plasmid#110848PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN552 (FuGW-S(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105202PurposeModule 1 - synthetic promoter USF1 drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 extracellular-cysteineless (NT864)
Plasmid#49069PurposeExpresses human NKCC1 mutant lacking extracellular cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC563S,C568S,C577S,C582S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
mPLD2-PX (62-192)
Plasmid#119128PurposeBacterial expression of human phox homology (PX) domain, mPLD2-PX (62-192)DepositorInsertmPLD2-PX (62-192)
TagsGSTExpressionBacterialPromotertacAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX17-PX (1-111)
Plasmid#119098PurposeBacterial expression of human phox homology (PX) domain, SNX17-PX (1-111)DepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX16-PX (104-216)
Plasmid#119097PurposeBacterial expression of human phox homology (PX) domain, SNX16-PX (104-216)DepositorInsertSNX16-PX (104-216) (SNX16 Human)
PromoterN/AAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX4-PX (48-186)
Plasmid#119085PurposeBacterial expression of human phox homology (PX) domain, SNX4-PX (48-186)DepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX32-PX (17-166)
Plasmid#119111PurposeBacterial expression of human phox homology (PX) domain, SNX32-PX (17-166)DepositorAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only