We narrowed to 81,726 results for: Mycs
-
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD104_Asn152Ser_pCMV6Entry-hIRG1
Plasmid#124877PurposeExpresses hCAD Asp152Ser mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated Asn152 to SerPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAD64_pCMV6_Entry_hIrg1
Plasmid#124879PurposeExpresses hCAD His103Ala mutant in mammalian cellsDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
Tagsmyc and FLAG tagsExpressionMammalianMutationmutated His103 to AlaPromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG657 H2B-pFAST
Plasmid#172862PurposeExpresses pFAST fused to zebrafish histone H2B in mammalian cellsDepositorInsertH2B-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG671 mito-pFAST
Plasmid#172867PurposeExpresses mitochondrial targeting domain-pFAST in mammalian cellsDepositorInsertmito-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHRIG-PRAS40
Plasmid#53599Purposelentiviral expression of constitutively active PRAS40 and EGFPDepositorInsertPRAS40 (AKT1S1 Human)
UseLentiviralTagsIRES-EGFP and mycExpressionMammalianMutationconstitutively active (myristoylated version)PromoterCMVAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRV FOXP3 WWRR
Plasmid#13625DepositorInsertFOXP3 (FOXP3 Human)
UseRetroviralTagsMycExpressionMammalianMutationWWRR: T359W, N361W, E399R, E401RAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-HsAIDSc
Plasmid#60810Purposeto express human AID recoded for yeast codon usageDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only