We narrowed to 17,253 results for: REV

#139497

Expression vector for the MS2-GFP protein in S. cerevisiae

Serge Pelet

Wosika et al Nat Commun. 2020 Jun 23;11(1):3171. doi:

June 4, 2020

Academic Institutions and Nonprofits only

#87707

Fluorescent biosensor for super-resolution imaging of ERK activity; targeted to plasma membrane.

Jin Zhang

Mo et al Nat Methods. 2017 Apr;14(4):427-434. doi

Feb. 22, 2018

Academic Institutions and Nonprofits only

#157656

GFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequence

Frank Albert

Brion et al Elife. 2020 Nov 16;9. pii: 60645. doi: 1

Sept. 9, 2020

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#73286

EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2

Irina Borodina

Jessop-Fabre et al Biotechnol J. 2016 Aug;11(8):1110-7. doi

Nov. 23, 2016

Academic Institutions and Nonprofits only

#73288

EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-5

Irina Borodina

Jessop-Fabre et al Biotechnol J. 2016 Aug;11(8):1110-7. doi

Nov. 23, 2016

Academic Institutions and Nonprofits only