We narrowed to 10,082 results for: crispr plasmids
-
Plasmid#189923PurposeAAV genome encoding SaKKHABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationnSaCas9 KKH, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEmax_2star_pet21A
Plasmid#227675PurposeExpression plasmid for PEMAX** protein in bacteria.DepositorInsertPEmax_2_star
UseCRISPRTagsHis-tagExpressionBacterialPromoterT7Available SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
P021-mPB-ENGRAM-All-in-one-PGK-BFP-P2A-Blast
Plasmid#239972PurposeUpdated ENGRAM plasmid that is ready for both 5' and 3'-FT ENGRAM cloningDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro
Plasmid#171991PurposeDelivers all prime editing nickase components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-PURO-LoxP-SNAP-TERT
Plasmid#71390PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes PURO resistance flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-3-FT-ENGRAM
Plasmid#179158PurposepiggyBac plasmid for 3'-FT ENGRAM recorderDepositorInsertCsy4
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterminPAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
2333_Cas9-CtIP-dnRNF168
Plasmid#200254PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cellsDepositorInsertCas9-CtIP-dnRNF168
ExpressionMammalianPromoterCMVAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8e-bGH-U6-sgRNA-BsmBI
Plasmid#189922PurposeAAV genome encoding SaABE8e and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e
UseAAVMutationSaCas9 D10APromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDY1513 AAVS1 sgRNA
Plasmid#234832PurposesgRNA for AAVS1 STITCHR insertionDepositorInsertAAVS1 sgRNA
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting
Plasmid#188541PurposePlasmid encoding pCas9 and gRNA targeting the endogenous human ABCA3 locus stop codonDepositorInsertgRNA
UseCRISPRTagsGFPPromoterU6Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0338 pAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
Plasmid#172514PurposeEncodes HvsCas7-11 DR and golden gate site for spacer clonings in an AAV backbone with U6 promoterDepositorInsertpAAV U6-HvsCas7-11 DR Rev-BpiI golden gate backbone dual vector
UseAAVAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_K95M
Plasmid#108106PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & kinase-dead mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_T221E
Plasmid#108108PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & TE mutation at LKB1 phosphorylation site) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only