We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_2b)-PGKpuro2ABFP-W
Plasmid#208415PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_1k)-PGKpuro2ABFP-W
Plasmid#208420PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_2b)-PGKpuro2ABFP-W
Plasmid#208421PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_1k)-PGKpuro2ABFP-W
Plasmid#208431PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hRNF31_1k)-PGKpuro2ABFP-W
Plasmid#208414PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tagDepositorInsertRNF31 (RNF31 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-CasRx-pA
Plasmid#233038PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-CasRx-pA/EF1a-mCherry-WPRE-pa
Plasmid#233032PurposeTo Express HA tagged CasRX the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertCasRx and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-L101_guide-CBh-hSpCas9
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only