We narrowed to 70,188 results for: nin
-
Plasmid#60651PurposeExpresses 6xHis-Ago2 (N-termi tag) mutated five serines to alanines in mammalian cellsDepositorInsertArgonaute 2 (AGO2 Human)
Tags6xHis (N-termi tag)ExpressionMammalianMutationmutated five serines to alaninesPromoterCMVAvailable SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3-CFP
Plasmid#50485Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChRBeta3 subunit, isoform 1 (Chrnb3 Mouse)
TagsCFPExpressionMammalianMutationCFP fusion in M3-M4 loop (after residue P379). O…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSico-syn-mGreenLantern:KASH-TVA-oG-6xMBS-WPRE-bGHpA
Plasmid#231010PurposeLentiviral helper virus for G-deleted rabies tracing. mGreenLantern:KASH fluorescence is not visible without immunostaining.DepositorInsertsUseLentiviralTagsKASHMutationPlease note that mGreenLantern-KASH is not visibl…Promoterhuman synapsin IAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1046)
Plasmid#226446PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1046) or for assays using M13 phageDepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-2455 to -1951)
Plasmid#226441PurposeFor subcloning of human EXOC3 promoter (base pairs -2455 to -1951) or for assays using M13 phageDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1046)
Plasmid#226444PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1046) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1591 to -1009)
Plasmid#226443PurposeFor subcloning of human EXOC3 promoter (base pairs -1591 to -1009) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1701 to -1594)
Plasmid#226442PurposeFor subcloning of human EXOC3 promoter (base pairs -1701 to -1594) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1444)
Plasmid#226445PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1444)
Plasmid#226447PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1444) or for assays using M13 phageDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBh-T7-SpG-P2A-mTagBFP2(RAS3583)
Plasmid#223110PurposepCBh Human expression plasmid for SpG with with C-term BPNLS-P2A-mTagBFP2DepositorInserthuman codon optimized nuclease SpG-P2A-mTagBFP2
UseCRISPRTagsBPNLS-3xFLAG-P2A-mTagBFP2ExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBh-T7-SpCas9-P2A-mTagBFP2(RAS3575)
Plasmid#223111PurposepCBh Human expression plasmid for SpCas9 with with C-term BPNLS-P2A-mTagBFP2DepositorInserthuman codon optimized nuclease SpCas9-P2A-mTagBFP2
UseCRISPRTagsBPNLS-3xFLAG-P2A-mTagBFP2ExpressionMammalianPromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-P2A-EGFP (MSP2582)
Plasmid#223067PurposepCAG human codon optimized wild-type SpCas9 expression plasmid with C-terminal NLS(SV40)-3xFLAG-P2A-EGFPDepositorInserthuman codon optimized SpCas9-P2A-EGFP
UseCRISPRTagsNLS(SV40)-3xFLAG-P2A-EGFPExpressionMammalianPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
Plasmid#223226PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)DepositorInsertNr1d1 (Nr1d1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; mSA-ePhi29 - pCMV-T7-mSA-Phi29 (JO1411)
Plasmid#217807PurposeUnfused click editor construct expressing mSA-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13 for template recruitment - pCMV-T7-Cdc13-nCas9-EcKlenow (JO1293)
Plasmid#217796PurposeVariant CE1 construct with Cdc13 telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only