We narrowed to 24,628 results for: promoter
-
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-shMBNL3-0455
Plasmid#115463PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(BsmBI)-EF1a-BFP-BSD-Dmap1(SDM)
Plasmid#117139PurposeExpression vector encoding BFP-BSD-HA-Dmap1 resistant against gRNA encoded by pKLV2-U6(gDmap1 v4)--PGK-Puro-BFPDepositorInsertHA-Dmap1 (mutagenised) (Dmap1 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationmodified BFP, modified Dmap1 CDSPromoterhuman U6 promoter, human EF1a promoterAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgSNAI1-2097
Plasmid#115453PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-mouseEC1.45
Plasmid#173972PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMouse orthologous SOX9 enhancer cluster EC1.45
UseLuciferaseMutationNonePromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Bin1b
Plasmid#176014PurposeMammalian expression of zebrafish EGFP-Bin1b. Parton lab clone HYGDepositorAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Nterm (23-504) pEF6-V5
Plasmid#73270PurposeExpression of mouse HDAC7-Nterm in mammalian cells (V5 tag)DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
RCAS-Neu HA SIINFEKL
Plasmid#125832PurposeRetroviral expression of rat Neu cDNADepositorInsertNeu (Erbb2 Rat)
UseRetroviralTags2x HA and SIINFEKLExpressionMammalianMutationVal to Glu point mutation of codon 664 and trunca…Available SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
XE129 beta2AR Fz1-pcDNA3.1
Plasmid#16795DepositorUseXenopus expressionMutationChimera of beta 2 adrenergic receptor (extracellu…Available SinceMarch 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEHC
Plasmid#112615Purposepromoterless expression plasmid driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsEmeraldExpressionMammalianPromoterNo PromoterAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC
Plasmid#112616Purposepromoterless expression plasmid driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsmTeal (mTFP1)ExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
Plasmid#73269PurposemHDAC7-U (23-938) pEF6-V5 (MJS_017) (Flag tag)DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-gap_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107577PurposeB. megaterium DSM319 gap promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromotergapdh promoter - B. megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 long
Plasmid#74469PurposeExpresses Cd99l2 transcript variant 1-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 1 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 short
Plasmid#74470PurposeExpresses Cd99l2 transcript variant 2-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 2 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only