We narrowed to 10,125 results for: Uty
-
Plasmid#123363PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance, Firefly luciferase, and nuclear EGFP.DepositorInsertEGFP-NLS
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mGreenLantern
Plasmid#220596PurposeConstitutive expression of a single-cell discriminating version of mGreenLantern fluorescent protein.DepositorInsertmGreenLantern
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
BmR1_04g07470-bio-His
Plasmid#108037PurposeExpresses enzymatically monobiotinylated full-length BmR1_04g07470 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBmR1_04g07470
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX317 TEAD2
Plasmid#193686PurposeConstitutive lentiviral expression of TEAD2DepositorInsertTEAD2 (TEAD2 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
L2096-GPA-BRET-Biosensor-Retrovirus-TD146
Plasmid#222878PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with BRET (split NanoLuciferase reconstitution [11S/114 fragment]). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA-NanoLuc114-CyOFP1-T2A-FKBP-GPA-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
TOMM20-mTurquoise-Cdc42-G12V-DeltaCaaX
Plasmid#176121PurposeConstitutivley active, mitochondrial localized Cdc42DepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQFDBD-2x AD*-VP16*, α-cry:EGFP
Plasmid#180473PurposeGene expression vector pQFDBD-2x AD*-VP16*, α-cry:EGFPDepositorInsertQFDBD-2xQFAD*-VP16*
UseSynthetic BiologyAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Caprola_on-mEGFP
Plasmid#194694PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_on-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX317-SNAI1
Plasmid#115446PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (5B)
Plasmid#85498PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32H H70C D158S I159A L162RPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PHB2 S39D-mCherry
Plasmid#232787PurposeEncodes an mCherry-tagged Prohibitin2/PHB2 constitutively phosphorylated on Ser39DepositorInsertPHB2 (PHB2 Human)
TagsmCherryExpressionMammalianMutationChanged Serine 39 to AspartatePromoterCMVAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT899
Plasmid#228288PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA1-28-pA
Plasmid#55200PurposePlasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
TACR1-DuET
Plasmid#213385PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pGFAP-AcGFP
Plasmid#133733PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a GFAP promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpGFAP and pTRE3G-BiAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
MRGPRX1-DuET
Plasmid#213344PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-CAGGS (JDW 912)
Plasmid#224472PurposeGateway compatible 5' entry clone containing the CAG promoter for constitutive expression of downstream constructs.DepositorInsertCAGGS Promoter
ExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX317-RBFOX1
Plasmid#115442PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Stat3 S727A pRc/CMV
Plasmid#8708DepositorInsertStat3 S727A (Stat3 Mouse)
ExpressionMammalianMutationS727A (exhibits o serine phosphorylation either c…Available SinceAug. 11, 2005AvailabilityAcademic Institutions and Nonprofits only