We narrowed to 62,810 results for: Ran
-
Plasmid#52358PurposeTALEN vector for targeting human MBD3 locus (5')DepositorInsertNI NN NN NN NN HD HD NI NN NG NG NN NG NN NN NN NN NG NN
UseTALENPromoterCAGGSAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase-PY3 mutant
Plasmid#17802DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00134_PGK-mNeonGreen-syn_pA-EF1alpha-TagBFP-syn_pA
Plasmid#252538PurposeConstitutive promoters with downstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
aRJ_00135_EF1alpha-TagBFP-syn_pA-PGK-mNeonGreen-syn_pA
Plasmid#252539PurposeConstitutive promoters with upstream tandem syntax for PiggyBac integrationDepositorInsertTagBFP
ExpressionMammalianPromoterhEF1a (human elongation factor 1-alpha), hPGK (hu…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi sgSOS1-2
Plasmid#253093PurposeCRISPRi single-guide against SOS1DepositorInsertSOS1 (SOS1 Human)
UseCRISPRAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi sgSOS1-1
Plasmid#253092PurposeCRISPRi single-guide against SOS1DepositorInsertSOS1 (SOS1 Human)
UseCRISPRAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lyn-FRB_star-P2A-mVenus-FKBP-5ptase
Plasmid#241305PurposeMammalian expression of Lyn-FRB_star and mVenus-FKBP-5ptase of INPP5EDepositorInsertINPP5E (INPP5E Human)
TagsmVenus, FKBPExpressionMammalianMutation214-644 aaPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(E49TAG,G42H,K46H)-mCherry
Plasmid#241292PurposeMammalian expression of syntaxin-1(E49TAG,G42H,K46H) fused to mCherry for genetic code expansion via Amber codon supressionDepositorInsertSyntaxin-1A (Stx1a Rat)
TagsmCherryExpressionMammalianMutationE49TAG,G42H,K46HPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(E53TAG,G42H,K46H)-mCherry
Plasmid#241294PurposeMammalian expression of syntaxin-1(E53TAG,G42H,K46H) fused to mCherry for genetic code expansion via Amber codon supressionDepositorInsertSyntaxin-1A (Stx1a Rat)
TagsmCherryExpressionMammalianMutationE53TAG,G42H,K46HPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(R210H,E206TAG)-mCherry
Plasmid#241296PurposeMammalian expression of syntaxin-1(E206TAG,R210H) fused to mCherry for genetic code expansion via Amber codon supressionDepositorInsertSyntaxin-1A (Stx1a Rat)
TagsmCherryExpressionMammalianMutationE206TAG,R210HPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(R210H,K84TAG)-mCherry
Plasmid#241298PurposeMammalian expression of syntaxin-1(K84TAG,R210H) fused to mCherry for genetic code expansion via Amber codon supressionDepositorAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(I233A,K84TAG)-mCherry
Plasmid#241299PurposeMammalian expression of syntaxin-1(I233A,K84TAG) fused to mCherry for genetic code expansion via Amber codon supressionDepositorAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(I233A,R210H,K84TAG)-mCherry
Plasmid#241300PurposeMammalian expression of syntaxin-1(I233A,K84TAG,R210H) fused to mCherry for genetic code expansion via Amber codon supressionDepositorInsertSyntaxin-1A (Stx1a Rat)
TagsmCherryExpressionMammalianMutationI233A,K84TAG,R210HPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syntaxin1A(K264A,K265A,K84TAG)-mCherry
Plasmid#241301PurposeMammalian expression of syntaxin-1(K264A,K265A,K84TAG) fused to mCherry for genetic code expansion via Amber codon supressionDepositorInsertSyntaxin-1A (Stx1a Rat)
TagsmCherryExpressionMammalianMutationK264A,K265A,K84TAGPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
mVenus-synaptojanin1(498-901)-CAAX
Plasmid#241303PurposeMammalian expression of truncated form of synaptojanin-1 with CAAX motif fused to mVenusDepositorInsertSynaptojanin-1 (SYNJ1 Human)
TagsmVenusExpressionMammalianMutation498-901 aaPromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-SNAP25B-WT
Plasmid#248121PurposeMammalian expression lentiviral vector encoding the wild-type Synaptosomal-Associated Protein (SNAP-25)DepositorAvailable SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only