We narrowed to 41,361 results for: Eras
-
Plasmid#131378PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid changes S308P and H309D in Gs MutY.DepositorInsertEcNGsC MutY chimera S308P H309D
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-S308A-pKK223
Plasmid#131379PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid changes F307A and S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S285C
Plasmid#98666PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285C and D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S329C
Plasmid#98668PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290V and S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R201K_R216K_R254K
Plasmid#104467Purposeexpress MBP hnRNPA2 LC with 4 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M3K5_HUMAN_D0
Plasmid#79710PurposeThis plasmid encodes the kinase domain of M3K5. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
DMPK_HUMAN_D0
Plasmid#79717PurposeThis plasmid encodes the kinase domain of DMPK. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KC1G1_HUMAN_D0
Plasmid#79691PurposeThis plasmid encodes the kinase domain of KC1G1. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSK22_HUMAN_D0
Plasmid#79704PurposeThis plasmid encodes the kinase domain of CSK22. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK215
Plasmid#72427PurposeAcetobacter aceti 1023 gDNADepositorInsertssuccinyl-diaminopimelate desuccinylase
2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase
acetylglutamate kinase
ribosome biogenesis GTP-binding protein YsxC
insertase
ribonuclease P
50S ribosomal protein L34
hypothetical protein
glyoxylase I
hypothetical protein
UDP-N-acetylglucosamine acyltransferase
3-hydroxyacyl-ACP dehydratase
UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase
UsePhage lambda cloning vector with genomic dna inse…Mutationmissing C-terminal domain residues 277-391(ter) a…Promotern/aAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K2S
Plasmid#62980PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 446-911 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K3S
Plasmid#62981PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 911-1406 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K4S
Plasmid#62982PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 1406-1781 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K6S
Plasmid#62983PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 2086-2639 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only