We narrowed to 19,679 results for: cat
-
Plasmid#52429Purposebacterial expression of human Mevalonate Kinase (MK)DepositorAvailable sinceApril 10, 2014AvailabilityAcademic Institutions and Nonprofits only
-
CtkA_D155Q/D179Q_pET21a
Plasmid#27432DepositorInsertCell translocating kinas A (jhp0940 H. pylori)
TagsHisExpressionBacterialMutationD155Q/D179QAvailable sinceMay 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
PBbtCRISPRko.v1
Pooled library#213928PurposeUses the PiggyBac transposon system to deliver the library into hard to transduce cellsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-Rh159-HA
Plasmid#179344PurposeAll-in-on "tet-on" 3G lentiviral vector plasmid encoding rhesus cytomegalovirus Rh159 (NK cell evasion protein) with a C-terminal HA tag fused to its cytoplasmic tailDepositorInsertRh159
UseLentiviral; All in one tet-on lentiviral vector (…TagsHA tagExpressionMammalianPromotertet responsive element 3GAvailable sinceAug. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLP-TK (pCTC174)
Plasmid#254034PurposemSwAP-In/Big-IN Landing Pad plasmid encoding pEF1a-driven PuroR-dTK-P2A-HaloTag expression cassette flanked by LoxM/LoxP sites and BsaI homology arms cloning sites. FCU1-counterselectable backbone.DepositorInsertPuroR-dTK-P2A-HaloTag
UseSynthetic Biology; Mouse targeting, recombinase-m…ExpressionMammalianPromoterhuman EF1aAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[WT] (pAVA3171)
Plasmid#239347PurposeExpresses full-length, driven by its own promoter MALAT1 with wild-type ENE and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta)Available sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-PDGFR-WPRE
Plasmid#234439PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10/RSV_XS3B-miniXon_Luciferase
Plasmid#217302PurposePlasmid containing the SF3B3-XS3B/Firefly luciferase cassette, a modification of the SF3B3-miniXon system. Translation of Firefly luciferase is controlled by splicing modulation of the SF3B3-XS3B by LDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertXS3B-miniXon
UseLuciferaseExpressionMammalianMutationKozak ATG initiation sequence in middle exonPromoterRSVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FUW-crRNA-scrambled-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194897PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and scrambled crRNA without target in human genome.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA-scramble
UseLentiviralTagsHAExpressionMammalianMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-human-CHMP3(150)
Plasmid#154181Purposeexpresses human CHMP3(150) in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCHMP3 (CHMP3 Human)
TagsFLAG and Strep-Tag IIExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 150PromoterCAGAvailable sinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H21
Plasmid#170335PurposeCFP(ST)_EPAC full length_Y(UST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCFP(ST)_EPAC full length_Y(UST) (RAPGEF3 Human)
ExpressionMammalianPromoterCMVAvailable sinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT 5N5A
Plasmid#154285PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; 5N5A variant, no HCF-1 cleavage)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertO-GlcNAc Transferase (OGT Human)
UseGateway CloningTags2x FLAG and mKate2MutationN322A, N356A, N390A, N424A, N458A mutations (HCF-…Available sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVenus-N-SLC35B2
Plasmid#155038PurposeTransient expression of SLC35B2-VenusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSLC35B2 (SLC35B2 Human)
TagsVenusExpressionMammalianMutationSee depositor comments belowPromoterCMVAvailable sinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-HIS-ELP-ddFLN4-I27-XMod-Doc (wild type)
Plasmid#153442PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 and I27 fingerprint domains. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, Titin I27, ddFLN4 fingerprin…ExpressionBacterialPromoterT7 promoterAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-Nsp7-Nsp8_GC3opt
Plasmid#157691Purposemammalian expression of untagged SARS-CoV-2 Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNsp7-Nsp8_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4133930
Plasmid#152574PurposeMammalian expression plasmid for SARS-CoV-2 S (surface glycoprotein)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSARS-CoV-2 S (surface glycoprotein) (S Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHis-003ExpressionMammalianMutationwtPromoterCMVAvailable sinceJune 18, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046286
Plasmid#149147PurposeYeast Expression plasmid for SARS-CoV-2 surface glycoprotein (Spike protein)DepositorInsertSARS-CoV-2 surface glycoprotein (S Budding Yeast, Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;3xFLAGExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpTEF1Available sinceMay 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRC/CMV-TYK2P1104A-VSV
Plasmid#139350PurposeExpression of the TYK2-P1104A variant, rs34536443DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
TagsVSVExpressionMammalianMutationV362F-P1104APromoterCMVAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by