We narrowed to 17,531 results for: IGH@
-
Plasmid#192367PurposetRNA sequence provider (for checkpoint and immune library)DepositorInsertGln tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gly-tRNA-gRNA scaffold for library 1
Plasmid#192368PurposetRNA sequence provider (for immune library)DepositorInsertGly tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pro-tRNA-gRNA scaffold for library 1
Plasmid#192369PurposetRNA sequence provider (for immune library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-R4-bpFOG-L5
Plasmid#186369PurposeEntry clone with ORF encoding Strong basal promoter of FOG flanked by Gateway recombination sequencesDepositorInsertBasal promoter of the Friend Of Gata gene
UseProtein expressionPromoterT7 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L3-pFOGl-L5
Plasmid#186364PurposeEntry clone with ORF encoding Ci-FOG cis-regulatory region flanked by Gateway recombination sequencesDepositorInsertFriend Of Gata regulatory sequence
UseProtein expressionPromoterT7 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA
Plasmid#186407PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA
Plasmid#186397PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA
Plasmid#186396PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned gene of interest under control of a regulatory sequence cloned in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L3-a-element-L4
Plasmid#186366PurposeEntry clone with ORF encoding Otx cis-regulatory region flanked by Gateway recombination sequencesDepositorInserta-element early Otx neural enhancer
UseProtein expressionPromoterT7 promoterAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-Venus-stop-L2
Plasmid#186360PurposeEntry clone with ORF encoding Venus fluorescent protein flanked by Gateway recombination sequencesDepositorInsertVenus yellow fluorescent protein
UseExpression of the venus fluorescent proteinAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS538
Plasmid#188881PurposeGateway Entry Vector [1-2]: 2xNLS::Cas9 (with 4 introns from smu-2)DepositorInsertCas9
UseGateway entry vectorMutationC. elegans codom optimization and intron additionAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-HA
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
IBAR-Cry2PHR-WH2
Plasmid#176605PurposeCry2PHR with N-terminal IBAR domain and C-terminal WH2 domainDepositorInsertIBAR-Cry2PHR-mCherry
ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cry2PHR-IBAR-WH2
Plasmid#176603PurposeCry2PHR with C-terminal IBAR and WH2 domainsDepositorInsertCry2PHR-mCherry-IBAR-WH2
ExpressionMammalianPromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mScarlet-I-mNeonGreen-ADH1term-TEFpr-hphΔC (pKBJ011)
Plasmid#173462PurposeC-SWAT donor for Selection Reconstitution tagging, contains mScarletI-mNeonGreen tandem fluorescent protein timerDepositorInsertmScarlet-I-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only