We narrowed to 9,463 results for: Pol
-
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGHUC w-ERBIN (2-hybrid prey plasmid)
Plasmid#128163PurposeUV5 promoter drives expression of omega-erbin fusion. Pair with pB1H2 UV5 Zif268-cons as a positive control (turns on HIS3/GFP).DepositorInsertERBIN PDZ domain (ERBIN Synthetic)
UseSynthetic BiologyTagsFLAG and Omega subunit of RNA polymeraseExpressionBacterialPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-POMP-PSMG1-PSMG2-PSMG3-PSMG4
Plasmid#214137PurposeInsect cell expression of the human 20SCP proteasome assembly chaperonesDepositorInsertsExpressionInsectPromoterpolyhedrinAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGS_101
Plasmid#160541PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GFP-dynein-2(D1091–Q4307)
Plasmid#64064PurposeCodon-optimized human dynein-2 motor domain (D1091–Q4307) for baculovirus expression. 6His-ZZ-GFP N-terminal tag, TEV site to cleave 6His-ZZ.DepositorInsertCytoplasmic dynein-2 (DYNC2H1 Human)
TagsGFP, His tag, and ZZ tagExpressionInsectMutationDeleted amino acids 1-1090, extra C-terminal vali…PromoterPolyhedrinAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSN840
Plasmid#184832PurposeExpresses human KIF5A(∆exon27) and human KLC1 in insect cellsDepositorUseCre/LoxTagsHis-FLAG and mScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterp10 and polyhedrinAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIV-EGFP.Flag-EZH2-mt2
Plasmid#220245PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2 (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationF32A, R34A, D36A, K39A, PRKKKR494-499NAAIRSPromoterEF-1αAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEW108
Plasmid#232823PurposeExpresses yeast compass complex in insect cellsDepositorInsertTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationSet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA position E2 (GB2239)
Plasmid#160561PurposetRNA and scaffold for the assembly of GBoligomers for position [2-3] of a polycistronic tRNA-gRNADepositorInserttRNA-gRNA position E2 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.RBBP4
Plasmid#125164PurposeExpresses human RBBP4 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorInsertHistone-binding protein RBBP4 (RBBP4 Human)
TagsHis-MBPExpressionInsectPromoterPolyhedrinAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGS_107
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_129
Plasmid#160652PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterpZ estradiol inducible promoterAvailable SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_K144N
Plasmid#88870Purposeconstitutive expression of Ha-DDX5 K144N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB1.HMBP.PrS.AEBP2
Plasmid#125165PurposeExpresses human AEBP2 in insect cells, , under a C3-cleavable (PreScission Protease) N-terminal hexahistidine-MBP tag.DepositorAvailable SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc sfCherry2ΔC4-Lifeact
Plasmid#231557PurposeMammalian expression of Lifeact fused to C-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only