We narrowed to 18,115 results for: sequence
-
Plasmid#29378DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationN58A mutant gene including genomic sequence 1432 …Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/UAA-mEGFP-IRES-mCherry
Plasmid#49234PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28-At_PRORP3-His
Plasmid#67871Purposebacterial expression of PRORP3 (At4g21900), full coding sequence + C-term. His tagDepositorAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD14
Plasmid#112822PurposepSMF2 with 14 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-Ds
Plasmid#119069PurposeTo clone sgRNA spacer sequence for microinjections in zebrafishDepositorInsertU6a:sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK2_026
Plasmid#123718PurposeEncodes crippled pSFFV as a Type 2 part to be used in the MTK systemDepositorInsertpSFFVc
ExpressionMammalianMutationCrippled Kozac sequenceAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_BpiI-cloning-site_SV40polyA
Plasmid#124547PurposeDestination cloning vector for tRNA-flanked sgRNA. A BpiI placeholder is present between a minimal ADE promoter and SV40 polyA sequence.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWPT-ACC/ACC/ACC-mEGFP-IRES-mCherry
Plasmid#49228PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTH734-CEN-minHIS3
Plasmid#38227DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH737-CEN-maxHIS3
Plasmid#38229DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3 (=GPD)Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH375-SUP45-P174Q
Plasmid#29383DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationP174Q mutant gene including genomic sequence 1432…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBTK205
Plasmid#110587PurposeBTK Type 3 coding sequence for golden gate assemblyDepositorInsertGFP optim-1
UseSynthetic BiologyAvailable SinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
peT3a-AqAdk_MVGDH
Plasmid#18092DepositorInsertadenylate kinase (kad A. aeolicus)
Tags6xHisExpressionBacterialMutationTyr 52 changed to Cys, Val 145 changed to Cys, …Available SinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
MTK4_004
Plasmid#123813PurposeEncodes spacer sequence as a Type 4 part to be used in the MTK systemDepositorInsertSpacer
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M9-IRES-CFP
Plasmid#114731PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M9
UseCRISPRExpressionMammalianAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)MBII-85-3'ss mut
Plasmid#67644PurposeMBII85 snoRNA expression cassett, contains snoRNA in natural intron sorounded by natural exons. To improve snoRNA expression efficiency 3' splice site was mutated to consensus sequences.DepositorInsertMBII85 snoRNA
ExpressionMammalianMutation3' splice site muattionAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD8
Plasmid#112820PurposepSMF2 with 8 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD10
Plasmid#112821PurposepSMF2 with 10 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK025
Plasmid#105415PurposeSynthetic biologyDepositorInsertHormone-binding domain and regulatory sequences (estrogen receptor)
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only