We narrowed to 34,982 results for: c-myc
-
Plasmid#73888PurposeI155A mutationDepositorInsertRet2 I155A
ExpressionYeastMutationIle 155 AlaPromoterMet25Available SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p415 Ret2 I149A
Plasmid#73887PurposeI149A mutationDepositorInsertRet2 I149A
ExpressionYeastMutationIle 149 AlaPromoterMet25Available SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p415 Ret2
Plasmid#73872PurposeRet2 (full length)DepositorInsertRet2
ExpressionYeastPromoterMet25Available SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSL3 - Brr2 del113 N1104L
Plasmid#90253Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 113 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL11 - Brr2 del422 N1104L
Plasmid#90261Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL12 - Brr2 del422 Q904E
Plasmid#90262Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid Q904EAvailabilityAcademic Institutions and Nonprofits only -
pSL13 - Brr2 del422 R1107L
Plasmid#90263Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid R110…AvailabilityAcademic Institutions and Nonprofits only -
pET21a_Msm_RbpA
Plasmid#87928PurposeMycobacterium smegmatis RpbA in pET21a (ampR) used to co-express with Msm SigA for crystallization purposesDepositorInsertRbpA
ExpressionBacterialPromoterT7PAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-Z3EV
Plasmid#157659PurposeGFP gene and gRNA under Z3EV expression control (estradiol sensor), with Z3EV transcription factor to insert in the genome.DepositorInsertGFP-gRNA NatMX Z3EV
UseInsert storage (replicative in e. coli)Available SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAV1-mEGFP
Plasmid#27704DepositorAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
Plas-gRNA-LEU2
Plasmid#157656PurposeGFP and gRNA tag for protein and mRNA quantification, to attache to the 3' end of the gene coding sequenceDepositorInsertGFP-gRNA
UseInsert storage (replicative in e. coli)TagsGFP-gRNAAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBES1-LacOx50-Hyg
Plasmid#210261PurposeIntegrates 50xLacO repeats upstream of the BES1 promoter with a hygromycin drug selection marker downstream of the promoter.DepositorInsert50xLacO repeats derived from: PMID: 12864855.
Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMito-dCherry-FRB
Plasmid#186573PurposeExpression of "dark MitoTrap" - an FRB-domain targeted to the mitochondria that is the same size as pMito-mCherry-FRB but is non-fluorescent - in human cellsDepositorInsertDark MitoTrap
ExpressionMammalianMutationMutation of "K70N" to render mCherry no…PromoterCMVAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only