We narrowed to 4,733 results for: GCA
-
Viral Prep#179255-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-jGCaMP8m-WPRE (#179255). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8m-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 (AAV9)
Viral Prep#112007-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 (#112007). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-GCaMP6s-P2A-mRuby3 plasmid DNA. hSyn-driven expression of calcium sensor GCaMP6s and bicistronic mRuby3. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmRuby3Available SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_GCaMP6f (AAV5)
Viral Prep#213833-AAV5PurposeReady-to-use AAV5 particles produced from pAAV_BiCHATe27_GCaMP6f (#213833). In addition to the viral particles, you will also receive purified pAAV_BiCHATe27_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the cholinergic neuron-targeting enhancer E27. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Ribo-jGCaMP8m (AAV1)
Viral Prep#167574-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Ribo-jGCaMP8m (#167574). In addition to the viral particles, you will also receive purified AAV-hSyn-Ribo-jGCaMP8m plasmid DNA. Synapsin-driven neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8s-WPRE (AAV Retrograde)
Viral Prep#176752-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CamKIIa-jGCaMP8s-WPRE (#176752). In addition to the viral particles, you will also receive purified AAV-CamKIIa-jGCaMP8s-WPRE plasmid DNA. CamKIIa-driven expression of calcium sensor GCaMP8s. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCamKIIalphaAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_CEACAM6-His
Plasmid#149337Purposefor eukaryotic expression and purification of CEACAM6-His6DepositorInsertCEACAM6 (CEACAM6 Human)
TagsIL-2 signal peptide and polyhistidineExpressionMammalianMutationpoint mutation (GGA to GCA) to replace 'G-g…PromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiVIPe4_GCaMP6f (AAV1)
Viral Prep#213859-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiVIPe4_GCaMP6f (#213859). In addition to the viral particles, you will also receive purified pAAV_BiVIPe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the VIP interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_GCaMP6f (AAV1)
Viral Prep#213818-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe10_GCaMP6f (#213818). In addition to the viral particles, you will also receive purified pAAV_BiSSTe10_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the SST interneuron-targeting enhancer E10. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_GCaMP6f (AAV1)
Viral Prep#213947-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe4_GCaMP6f (#213947). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the SST interneuron-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-jGCaMP8f-WPRE (AAV9)
Viral Prep#176750-AAV9PurposeReady-to-use AAV9 particles produced from AAV-CamKIIa-jGCaMP8f-WPRE (#176750). In addition to the viral particles, you will also receive purified AAV-CamKIIa-jGCaMP8f-WPRE plasmid DNA. CamKIIa-driven expression of calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCamKIIalphaAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Ribo-jGCaMP8s (AAV1)
Viral Prep#167572-AAV1PurposeReady-to-use AAV1 particles produced from AAV-hSyn-Ribo-jGCaMP8s (#167572). In addition to the viral particles, you will also receive purified AAV-hSyn-Ribo-jGCaMP8s plasmid DNA. Synapsin-driven neuronal expression of soma-targeted (RL-10, ribosomal tag) jGCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_BiPVe3_GCaMP6f (AAV PHP.eB)
Viral Prep#213943-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiPVe3_GCaMP6f (#213943). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the PV+ basket cell-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV5)
Viral Prep#162376-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-H2B-jGCaMP8s-WPRE (AAV9)
Viral Prep#176749-AAV9PurposeReady-to-use AAV9 particles produced from AAV-Syn-H2B-jGCaMP8s-WPRE (#176749). In addition to the viral particles, you will also receive purified AAV-Syn-H2B-jGCaMP8s-WPRE plasmid DNA. Syn-driven expression of histone H2B fused to calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe4_GCaMP6f (AAV1)
Viral Prep#213939-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe4_GCaMP6f (#213939). In addition to the viral particles, you will also receive purified pAAV_BiPVe4_GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the chandelier cell-targeting enhancer E4. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8f (AAV Retrograde)
Viral Prep#169258-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-hSyn-Soma-jGCaMP8f (#169258). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8f plasmid DNA. Synapsin-driven neuronal expression of soma-targeted calcium sensor jGCaMP8f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#176757-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-EF1a-jGCaMP8m-WPRE (#176757). In addition to the viral particles, you will also receive purified AAV-EF1a-jGCaMP8m-WPRE plasmid DNA. EF1a-driven expression of calcium sensor GCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-mDlx-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#176754-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-mDlx-jGCaMP8m-WPRE (#176754). In addition to the viral particles, you will also receive purified AAV-mDlx-jGCaMP8m-WPRE plasmid DNA. mDlx enhancer-driven expression of calcium sensor GCaMP8m in GABA-ergic interneurons. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only