We narrowed to 4,666 results for: gca
-
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-B
Plasmid#177812PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-A
Plasmid#177784PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbATML1-2pro and NbATML1-1pro
Plasmid#231155PurposeT-DNA encoding TRV2 with mobile gRNAs targeting NbATML1-2pro and NbATML1-1proDepositorInsertmobile gRNAs targeting NbATML1-2pro and NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (FANCC)
Plasmid#180192PurposeAAV vector carrying a guide RNA targeting the human FANCC mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdTCas9_scr
Plasmid#207568PurposedThermoCas9-mediated silencing of genomic gene in E. coliDepositorInsertPlac/tet_dThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationThermoCas9(D8A,H582A)Available SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only